Polymorphic members of the lag gene family mediate kin discrimination in Dictyostelium

Self and kin discrimination are observed in most kingdoms of life and are mediated by highly polymorphic plasma membrane proteins. Sequence polymorphism, which is essential for effective recognition, is maintained by balancing selection. Dictyostelium discoideum are social amoebas that propagate as unicellular organisms but aggregate upon starvation and form fruiting bodies with viable spores and dead stalk cells. Aggregative development exposes Dictyostelium to the perils of chimerism, including cheating, which raises questions about how the victims survive in nature and how social cooperation persists. Dictyostelids can minimize the cost of chimerism by preferential cooperation with kin, but the mechanisms of kin discrimination are largely unknown. Dictyostelium lag genes encode transmembrane proteins with multiple immunoglobulin (Ig) repeats that participate in cell adhesion and signaling. Here, we describe their role in kin discrimination. We show that lagB1 and lagC1 are highly polymorphic in natural populations and that their sequence dissimilarity correlates well with wild-strain segregation. Deleting lagB1 and lagC1 results in strain segregation in chimeras with wild-type cells, whereas elimination of the nearly invariant homolog lagD1 has no such consequences. These findings reveal an early evolutionary origin of kin discrimination and provide insight into the mechanism of social recognition and immunity

Mechanical loss of a multilayer tantala/silica coating on a sapphire disk at cryogenic temperatures: toward the KAGRA gravitational wave detector

We report the results of a new experimental setup to measure the mechanical loss of coating layers on a thin sapphire disk at cryogenic temperatures. Some of the authors previously reported that there was no temperature dependence of the mechanical loss from a multilayer tantala/silica coating on a sapphire disk, both before and after heat treatment, although some reports indicate that Ta<sub>2</sub>O<sub>5</sub> and SiO<sub>2</sub> layers annealed at 600 °C have loss peaks near 20 K. Since KAGRA—the Japanese gravitational-wave detector, currently under construction—will be operated at 20 K and have coated sapphire mirrors, it is very important to clarify the mechanical loss behavior of tantala/silica coatings around this temperature. We carefully investigate a tantala/silica-coated sapphire disk with the new setup, anneal the disk, and then investigate the annealed disk. We find that there is no distinct loss peak both before and after annealing under particular conditions. The mechanical loss for the unannealed disk at 20 K is about 5×10<sup>−4</sup>, as previously reported, while that for the annealed disk is approximately 6.4×10<sup>−4</sup>

Detection of L-Proline-Catalyzed Michael Addition Reaction in Model Biomembrane

A method to detect the L-proline- (L-Pro-) catalyzed Michael addition reaction in model biomembranes has been established, using N-[p(2-benzimidazolyl)phenyl]maleimide and acetone as reactants. The effect of liposome membranes on this reaction was kinetically analyzed using fluorescence spectroscopy. The kinetics of the reaction were different from those of the constituent lipids of the liposomes. Zwitterionic 1,2-dipalmitoyl-sn-glycero-3-phosphocholine liposome, which is in the solid-ordered phase, had a better value of reaction rate, suggesting that the reaction rate constants of this reaction in liposome membrane systems could be regulated by the characteristics of the liposome membrane (i.e., the phase state and surface charge). Based on the results obtained, a plausible model of the L-Pro-catalyzed Michael addition reaction was discussed. The obtained results provide us with an easily detectable method to assess the reactivity of L-Pro in biological systems

cis-Acting Site Controlling Bidirectional Transcription at the Growth-Differentiation Transition in Dictyostelium discoideum

A pair of adjacent genes, impA and dia1, are divergently transcribed but expressed at different stages in the life cycle of Dictyostelium discoideum. The intervening 654-bp region carries cis-acting regions that are essential for transcription in both directions as well as repression of dia1 in growing cells. We have focused on a 112-bp region proximal to dia1 that is essential for bidirectional transcription. Analyses of a set of internal deletions showed that the sequence between positions 80 and 97 (TTTGAATTTTTTGAATTT) is critical and that bases outside this region are dispensable. Site-directed mutations within this critical region confirmed the importance of this sequence for transcription both to the right and to the left. However, insertions of either 6 or 24 Ts into the run of 6 Ts separating the repeated GAA sequence had little effect on the functioning of the site in either direction, suggesting that factors recognize the half-sites TTGAATT separately. Inversion of the bases between positions 80 and 97 greatly reduced expression in both directions, indicating that orientation is critical for expression of both the nearby impA gene and the distal dia1 gene, which is more than 500 bp away. Comparison of 38 mutant constructs with multiple random variations in the region indicated that transcription factors may bind to a range of related sequences and still retain function. All functional constructs directed transcription both leftward and rightward, while all nonfunctional constructs were impaired for transcription in both directions. It appears that the same transcription complex controls transcription of both impA and dia1

Kin Recognition Protects Cooperators against Cheaters

SummaryThe evolution of sociality and altruism is enigmatic because cooperators are constantly threatened by cheaters who benefit from cooperation without incurring its full cost [1, 2]. Kin recognition is the ability to recognize and cooperate with genetically close relatives. It has also been proposed as a potential mechanism that limits cheating [3, 4], but there has been no direct experimental support for that possibility. Here we show that kin recognition protects cooperators against cheaters. The social amoebae Dictyostelium discoideum cooperate by forming multicellular aggregates that develop into fruiting bodies of viable spores and dead stalk cells. Cheaters preferentially differentiate into spores while their victims die as stalk cells in chimeric aggregates. We engineered syngeneic cheaters and victims that differed only in their kin-recognition genes, tgrB1 and tgrC1, and in a single cheater allele and found that the victims escaped exploitation by different types of nonkin cheaters. This protection depends on kin-recognition-mediated segregation because it is compromised when we disrupt strain segregation. These findings provide direct evidence for the role of kin recognition in cheater control and suggest a mechanism for the maintenance of stable cooperative systems

Transcriptional Switch of the dia1 and impA Promoter during the Growth/Differentiation Transition

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition

Unusual preservation of fossil mantis shrimp (Stomatopoda): occurrence of mandibles from the Pleistocene Ogushi Formation, Kyushu, Japan

Ando, Yusuke, Ugai, Hiroaki, Kawano, Shigenori, Hirose, Koji, Nakatani, Daisuke, Kurosu, Hiromi, Karasawa, Hiroaki (2013): Unusual preservation of fossil mantis shrimp (Stomatopoda): occurrence of mandibles from the Pleistocene Ogushi Formation, Kyushu, Japan. Zootaxa 3691 (2): 291-294, DOI: 10.11646/zootaxa.3691.2.