"Macromolecules to PDMS Transfer" as a General Route for PDMS Biochips

"Macromolecules to PDMS transfer" technique relying on the direct entrapment of macromolecules spots during PDMS polymerisation is proposed as an alternative for the easy and simple PDMS surface modification. In the present work, the development of three different applications based on this procedure is presented as proof of the method potentialities. First, C-reactive protein (CRP) sandwich immunoassay using immobilised monoclonal anti-CRP antibodies was developed for sepsis diagnosis. The preserved integrity of the immobilised monoclonal immunoglobulin permitted the sensitive detection of free CRP in human sera (LOD= 12.5µg/L, detection ranging over two decades). Then, rheumatoid arthritis diagnosis through the rheumatoid factor (RF) detection based on rabbit immunoglobulins immobilisation allowed the detection of specific antibodies in human sera samples down to low RF levels (detection range 5.3-485 IU/mL). Finally, the "Macromolecules to PDMS transfer" procedure was used to easily and rapidly produce fibronectin-based cell culture arrays. The successful attachment of HeLa and BALB/3T3 cells was demonstrated with optical microscopy and specific staining of actin and vinculin.JRC.DDG.I.5-Nanobioscience

Macromolecules to PDMS transfer" as a general route for PDMS biochips

International audienc

Methods for Multiplex Template Sampling in Digital PCR Assays

<div><p>The efficient use of digital PCR (dPCR) for precision copy number analysis requires high concentrations of target molecules that may be difficult or impossible to obtain from clinical samples. To solve this problem we present a strategy, called Multiplex Template Sampling (MTS), that effectively increases template concentrations by detecting multiple regions of fragmented target molecules. Three alternative assay approaches are presented for implementing MTS analysis of chromosome 21, providing a 10-fold concentration enhancement while preserving assay precision.</p></div

Effect of volume on dPCR reactions.

<p>Performance of same PCR mixes as in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0098341#pone-0098341-g001" target="_blank">Figure 1B</a> in 100 pL volumes. Two multiplexing approaches are compared: short primers and long primers plus a pair of universal primers. Multiplexing level in PCR reactions (horizontal axis) increases from 1× to 10×. Asterisks denote data points where difference between the two approaches was not significant (p = 0.05).</p

Multiplex Template Sampling (MTS) strategies.

<p>In the first, “short multiplex”, the sampling rate is raised by ten primer pairs in a multiplexed PCR with a common fluorescent probe for detection. The second method, “long multiplex”, is similar, but loci-specific primers are longer and we append a universal sequence to them. A third method, “repetitive simplex”, uses a single PCR assay designed to target chromosome-specific repetitive sequences.</p

dPCR quality comparison between “short” and “long” multiplexing strategies.

<p>(<b>A</b>) Boxplots for comparison of Ct values (vertical axis) distribution in 2 nL PCR compartments filled with variable multiplexing level (horizontal axis) primer mixes. Upper panel – PCR mixes supplemented with short primers. Lower panel – PCR mixes supplemented with combination of long and plus a pair of universal primers. Red crosses denote outliers that are larger than the 75^th percentile plus 1.5× the interquartile range or smaller than the 25^th percentile minus 1.5× the interquartile range. This corresponds to approximately ±2.7σ and 99.3% coverage assuming that the data are normally distributed. (<b>B</b>) The ratio between mean fluorescence in positive chambers in dPCR arrays and background fluorescence in negative chambers.</p

High-Throughput Microfluidic Single-Cell Digital Polymerase Chain Reaction

Here we present an integrated microfluidic device for the high-throughput digital polymerase chain reaction (dPCR) analysis of single cells. This device allows for the parallel processing of single cells and executes all steps of analysis, including cell capture, washing, lysis, reverse transcription, and dPCR analysis. The cDNA from each single cell is distributed into a dedicated dPCR array consisting of 1020 chambers, each having a volume of 25 pL, using surface-tension-based sample partitioning. The high density of this dPCR format (118 900 chambers/cm²) allows the analysis of 200 single cells per run, for a total of 204 000 PCR reactions using a device footprint of 10 cm². Experiments using RNA dilutions show this device achieves shot-noise-limited performance in quantifying single molecules, with a dynamic range of 10⁴. We performed over 1200 single-cell measurements, demonstrating the use of this platform in the absolute quantification of both high- and low-abundance mRNA transcripts, as well as micro-RNAs that are not easily measured using alternative hybridization methods. We further apply the specificity and sensitivity of single-cell dPCR to performing measurements of RNA editing events in single cells. High-throughput dPCR provides a new tool in the arsenal of single-cell analysis methods, with a unique combination of speed, precision, sensitivity, and specificity. We anticipate this approach will enable new studies where high-performance single-cell measurements are essential, including the analysis of transcriptional noise, allelic imbalance, and RNA processing

Pairs of long and short oligonucleotides used in multiplexed PCR reactions.

<p>Short primers are shown in bold. The first ten pairs target different loci on chromosome 21. The last pair targets RNAse P on chromosome 6. The oligonucleotides used for long multiplex experiments are full sequences listed in the table, with the addition of the universal sequence GACTGACTGCGTAGGTATTATCG (designated as U1 in the table) for forward primers and CACAGGAAACAGCTATGACC (designated as U2 in the table) for the reverse at 5′ end of the primers. The primers used for the repetitive simplex experiments target ten loci on chromosome 21 and were CCTGGTCTGCACCCCAGTG and GTGCAGGAGCTGGTGCAG, and were used with probe #74 (Cat. #04688970001) from the Roche Universal Probe Library which anneals to the CTGCTGCCC motif.</p>*<p>Universal sequences on 5′ ends of long pairs are not shown.</p

Assessment of chromosome ratio using “short” and “long” multiplexing strategies.

<p>(<b>A</b>) Mean ratio (n = 5) between chromosomes 21 and 6 in normal human adult male DNA as measured by dPCR using ten different primer pairs each specific to one locus on chromosome 21. (<b>B</b>) Mean ratio (n = 5) between chromosome 21 and chromosome 6 as measured by dPCR using multiplexed reactions with one to ten primer pairs in the PCR mix. Reaction volumes are 2 nL, multiplexing level (horizontal axis) increases from 1× to 10×. Two approaches compared: with short primers and long primers plus a pair of universal primers. Upper and lower boundaries of 95% confidence intervals <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0098341#pone.0098341-Dube1" target="_blank">[22]</a> are shown with dashed lines.</p