TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcayji-hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcayji-hes mice. Additionally, supplementation of homozygous Atcayji-hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM

Functionally Annotating Regulatory Elements in the Equine Genome Using Histone Mark ChIP-Seq.

One of the primary aims of the Functional Annotation of ANimal Genomes (FAANG) initiative is to characterize tissue-specific regulation within animal genomes. To this end, we used chromatin immunoprecipitation followed by sequencing (ChIP-Seq) to map four histone modifications (H3K4me1, H3K4me3, H3K27ac, and H3K27me3) in eight prioritized tissues collected as part of the FAANG equine biobank from two thoroughbred mares. Data were generated according to optimized experimental parameters developed during quality control testing. To ensure that we obtained sufficient ChIP and successful peak-calling, data and peak-calls were assessed using six quality metrics, replicate comparisons, and site-specific evaluations. Tissue specificity was explored by identifying binding motifs within unique active regions, and motifs were further characterized by gene ontology (GO) and protein-protein interaction analyses. The histone marks identified in this study represent some of the first resources for tissue-specific regulation within the equine genome. As such, these publicly available annotation data can be used to advance equine studies investigating health, performance, reproduction, and other traits of economic interest in the horse

The effect of a lumbopelvic compression belt on load transfer during the active straight leg test: A proof of concept study using ultrasound imaging

INTRODUCTION: The active straight leg raise (ASLR) test assesses load transfer through the pelvis. During the ASLR, intraabdominal pressure (IAP) rises, increasing the load on the lumbopelvic region. Several studies have shown a correlation between the magnitude of bladder base displacement (BBD) during the ASLR and lumbopelvic instability. Additionally, greater depression of the bladder and pelvic floor muscles is associated with motor control impairments associated with form and force closure. Pelvic stability belts are a common therapeutic intervention for individuals who report pelvic girdle pain. Their mechanism of action is to improve form closure and assist force closure and motor control. Impaired form and force closure mechanisms through the lumbopelvic area are associated poor load transfer, low back pain, sacroiliac pain, stress urinary incontinence and chronic pelvic pain. OBJECTIVES: This study aimed to observe and determine the impact of the ASLR test with and without a Serola lumbopelvic belt on BBD and participant self-reported level of difficulty score. METHODS: A convenience sample of fifteen physical therapy students (mean age 25 years) who were previously identified as having lumbopelvic instability were recruited for this study. PCOM\u27s institutional review board approved the study, and each participant provided informed consent. All participants completed a bladder filling protocol via natural diuresis to standardize bladder volumes to allow for bladder and pelvic floor delineation on ultrasound imaging. A Clarius C3 curvilinear wireless ultrasound unit was used for image acquisition with images displayed on an IPAD. The ultrasound transducer was placed suprapublically on the lower abdomen, oriented transversely, and manipulated until a clear image of the bladder base was apparent. A standard script was read to each participant to standardize testing. The magnitude of BBD was captured with cine loops across two testing conditions: the ASLR test without a lumbopelvic belt which was repeated with the participant wearing a belt. Participants also self-reported the level of difficulty for each testing condition. Participants were fitted with the lumbopelvic belt according to manufacturer’s recommendation. The belt tension was standardized using a manometer set to 20mmHG placed between the belt\u27s anterior aspect and the participant\u27s lower abdomen. On-screen calipers identified the lateral and medial aspects of the bladder base. All images were saved for post hoc analysis to determine the magnitude and direction of BBD between both testing conditions. RESULTS: Descriptive statistics will be reported, and a repeated measures ANOVA will be completed to determine whether there is a statistically significant difference between the means with the level of significance set at p=.05. CONCLUSION: TB

Dengue Virus Infection of Aedes aegypti Requires a Putative Cysteine Rich Venom Protein

Citation: Londono-Renteria, B., Troupin, A., Conway, M. J., Vesely, D., Ledizet, M., Roundy, C. M., . . . Colpitts, T. M. (2015). Dengue Virus Infection of Aedes aegypti Requires a Putative Cysteine Rich Venom Protein. Plos Pathogens, 11(10), 23. doi:10.1371/journal.ppat.1005202Dengue virus (DENV) is a mosquito-borne flavivirus that causes serious human disease and mortality worldwide. There is no specific antiviral therapy or vaccine for DENV infection. Alterations in gene expression during DENV infection of the mosquito and the impact of these changes on virus infection are important events to investigate in hopes of creating new treatments and vaccines. We previously identified 203 genes that were >= 5-fold differentially upregulated during flavivirus infection of the mosquito. Here, we examined the impact of silencing 100 of the most highly upregulated gene targets on DENV infection in its mosquito vector. We identified 20 genes that reduced DENV infection by at least 60% when silenced. We focused on one gene, a putative cysteine rich venom protein (SeqID AAEL000379; CRVP379), whose silencing significantly reduced DENV infection in Aedes aegypti cells. Here, we examine the requirement for CRVP379 during DENV infection of the mosquito and investigate the mechanisms surrounding this phenomenon. We also show that blocking CRVP379 protein with either RNAi or specific antisera inhibits DENV infection in Aedes aegypti. This work identifies a novel mosquito gene target for controlling DENV infection in mosquitoes that may also be used to develop broad preventative and therapeutic measures for multiple flaviviruses

Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcayji-hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcayji-hes mice. Additionally, supplementation of homozygous Atcayji-hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM