173 research outputs found
Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification
Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2)(−), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)–G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer
A novel expression cassette delivers efficient production of exclusively tetrameric human butyrylcholinesterase with improved pharmacokinetics for protection against organophosphate poisoning
© 2015 Published by Elsevier B.V. Butyrylcholinesterase is a stoichiometric bioscavenger against poisoning by organophosphorus pesticides and nerve agents. The low level of expression and extremely rapid clearance of monomeric recombinant human butyrylcholinesterase (rhBChE) from bloodstream (t1/2;≈2 min) limits its pharmaceutical application. Recently (Ilyushin at al., PNAS, 2013) we described a long-acting polysialylated recombinant butyrylcholinesterase (rhBChE-CAO), stable in the bloodstream, that protects mice against 4.2 LD50 of VR. Here we report a set of modifications of the initial rhBChE expression vector to improve stability of the enzyme in the bloodstream and increase its production in CHO cells by introducing in the expression cassette: (i) the sequence of the natural human PRAD-peptide in frame with rhBChE gene via "self-processing" viral F2A peptide under control of an hEF/HTLV promoter, and (ii) previously predicted in silico MAR 1-68 and MAR X-29 sequences. This provides fully tetrameric rhBChE (4rhBChE) at 70 mg/l, that displays improved pharmacokinetics (t1/2; = 32 ± 1.2 h, MRT = 43 ± 2 h). 3D Fluorescent visualization and distribution of 125I-labeled enzyme reveals similar low level 4rhBChE and rhBChE-CAO accumulation in muscle, fat, and brain. Administered 4rhBChE was mainly catabolized in the liver and breakdown products were excreted in kidney. Injection of 1.2 LD50 and 1.1 LD50 of paraoxon to BALB/c and knockout BChE-/- mice pre-treated with 4rhBChE (50 mg/kg) resulted in 100% and 78% survival, respectively, without perturbation of long-term behavior. In contrast, 100% mortality of non-pre-treated mice was observed. The high expression level of 4rhBChE in CHO cells permits consideration of this new expression system for manufacturing BChE as a biopharmaceutical
Mechanisms of the noxious inflammatory cycle in cystic fibrosis
Multiple evidences indicate that inflammation is an event occurring prior to infection in patients with cystic fibrosis. The self-perpetuating inflammatory cycle may play a pathogenic part in this disease. The role of the NF-κB pathway in enhanced production of inflammatory mediators is well documented. The pathophysiologic mechanisms through which the intrinsic inflammatory response develops remain unclear. The unfolded mutated protein cystic fibrosis transmembrane conductance regulator (CFTRΔF508), accounting for this pathology, is retained in the endoplasmic reticulum (ER), induces a stress, and modifies calcium homeostasis. Furthermore, CFTR is implicated in the transport of glutathione, the major antioxidant element in cells. CFTR mutations can alter redox homeostasis and induce an oxidative stress. The disturbance of the redox balance may evoke NF-κB activation and, in addition, promote apoptosis. In this review, we examine the hypotheses of the integrated pathogenic processes leading to the intrinsic inflammatory response in cystic fibrosis
- …