data nocturnal departure time and sun elevation

There are ten columns: 1. “dep.min.sunset”: This variable details the individual nocturnal departure timing in minutes after sunset. 2. “sunele.dep.2”: This variable details the sun’s elevation at the moment of the nocturnal departure in degrees below the horizon. 3. “Sex”: "Sex": This is a factor with two levels. "1" says that the bird was a male and "2" that it was a female. 4. "Age.ad": This is a factor with two levels, i.e., "young" and "old". In autumn, "young" means 1st calendar year bird and "old" means that the individual was older than "young". In spring, "young" means 2nd calendar year bird and "old" means that the individual was older than "young". 5. "subsp": This is a factor with two levels. "leu" says that the bird belonged to the leucorhoa subspecies of the northern wheatear and "oen" says that the bird belonged to the oenanthe subspecies of the northern wheatear. 6. “season”: This variable indicates whether the bird was caught in spring or autumn. 7. “energystores_release”: This is a numeric variable and it provides the individual energy stores at release, estimated as detailed in eqn. 2 of the paper. 8. “year”: This variable indicates the year in which the bird was caught. 9. “jd_arr”: This is the day of year of capture with 1 Jan is 1. 10. “rho.act.dep”: We converted departure direction (circular variable) into a measure of deviance between observed (radio-tracked) departure direction and seasonally appropriate migration direction which enabled the inclusion of directional information in subsequent multivariate analyses, cf. Müller et al. (2018, Journal of Animal Ecology, https://doi.org/10.1111/1365-2656.12821 ). This measure of deviance, the resultant vector length ρ (rho; rho of departure direction), was calculated using the “circ.summary” function of the R package “circular”, for details see corresponding paper. It ranges from 1 (no deviance between observed departure direction and seasonally appropriate migration direction) to 0 (deviance of 180°)

data rates of energy accumulation

There are seven columns: 1. “subsp”: This is a factor with two levels. "leu" says that the bird belonged to the leucorhoa subspecies of the northern wheatear and "oen" says that the bird belonged to the oenanthe subspecies of the northern wheatear. 2. "Age.ad": This is a factor with two levels, i.e., "young" and "old". In autumn, "young" means 1st calendar year bird and "old" means that the individual was older than "young". In spring, "young" means 2nd calendar year bird and "old" means that the individual was older than "young". 3. “season”: This variable indicates whether the bird was caught in spring or autumn. 4. “change.energystores_average”: This numeric variable details the change in the energy stores as an average value over the bird’s duration of stay in a cage. This value was calculated, as detailed in eqn. 3 of the paper. In the paper, this variable is called “rate of energy accumulation”. 5. “nights_in_cage”: This variable states how many nights a bird was in a cage. 6. “year”: This variable indicates the year in which the bird was caught. 7. “Sex”: This is a factor with two levels. "1" says that the bird was a male and "2" that it was a female

data departure direction

There are six columns: 1. “year”: This variable indicates the year in which the bird was caught. 2. “season”: This variable indicates whether the bird was caught in spring or autumn. 3. "subsp": This is a factor with two levels. "leu" says that the bird belonged to the leucorhoa subspecies of the northern wheatear and "oen" says that the bird belonged to the oenanthe subspecies of the northern wheatear. 4. "Age.ad": This is a factor with two levels, i.e., "young" and "old". In autumn, "young" means 1st calendar year bird and "old" means that the individual was older than "young". In spring, "young" means 2nd calendar year bird and "old" means that the individual was older than "young". 5. "Sex": This is a factor with two levels. "1" says that the bird was a male and "2" that it was a female. 6. “direction”: This is the departure direction in degree

data capture dates and energy stores

There are seven columns: 1. "energystores_capture": This is a numeric variable and it provides the individual energy stores at capture, estimated as detailed in eqn. 2 of the paper. 2. "Age.ad": This is a factor with two levels, i.e., "young" and "old". In autumn, "young" means 1st calendar year bird and "old" means that the individual was older than "young". In spring, "young" means 2nd calendar year bird and "old" means that the individual was older than "young". 3. "Sex": This is a factor with two levels. "1" says that the bird was a male and "2" that it was a female. 4. "subsp": This is a factor with two levels. "leu" says that the bird belonged to the leucorhoa subspecies of the northern wheatear and "oen" says that the bird belonged to the oenanthe subspecies of the northern wheatear. 5. “season”: This variable indicates whether the bird was caught in spring or autumn. 6. “year”: This variable indicates the year in which the bird was caught. 7. “jd”: This is the day of year of capture with 1 Jan is 1

Data_Mueller_et_al._2018

This Zip archive includes two csv-files. These files provide all data used for the analyses included in the research article

Hydrolysis of D- or L-RNA2 at different D- or L- DNAzyme ratios.

<p>Panel (A) D-DNAzyme hydrolysis of D-RNA2 at enzyme to substrate ratios as indicated in the lanes of the figure. Lane C: D-RNA2 incubated only in buffer, lane C’: D-RNA2 incubated in buffer with 10 mM MgCl₂. Panel (B) L-DNAzyme hydrolysis of L-RNA2 at enzyme to substrate ratios as indicated in the lanes of the figure. Lane C: L-RNA2 incubated only in buffer, lane C’: L-RNA2 incubated in buffer with 10 mM MgCl₂. (C) D-DNAzyme hydrolysis of D-RNA2 (black circles) at enzyme to substrate ratios as indicated in the figure and L-DNAzyme hydrolysis of L-RNA2 (gray squares) at ribozyme to substrate ratios shown in the panel. Incubation periods 3 h for all other conditions see Materials and Methods.</p

Hydrolysis Experiments of L-RNA2 with T1, V1, S1, and T2 Ribonucleases.

<p>Incubation conditions as described under Materials and Methods. L: alkaline L-RNA2 ladder. The nucleotide sequence of L-RNA2 is indicated. All nucleases were active against D-RNA (data not shown).</p

Hammerhead Spiegelzyme Activities in COS-7 cells.

<p>(A) Cells were transfected with 5′-fluorescein labeled L-RNA-1 substrates. Prior to the application of the HH Spiegelzyme, the cells were washed to remove the untransfected substrate from the medium. Then the cells were transfected with 300, 500, 1000 and 3000 nM of the Spiegelzyme. The control transfection was done only with the substrate. To check for the ability of the Spiegelzyme to cross the membrane, the cells were transfected with the fluorescein labeled Spiegelzyme (bottom row, right panel). The microscopic images were taken prior to RNA isolation after washing with PBS buffer. (B) The percentage of uncleaved substrate in the L-RNA-1 isolated from cells transfected with the Spiegelzyme. After incubation for 24 hours, L-RNA was isolated from harvested cells using TRIZOL (Ambion) according to the manufacturer’s protocol. L-RNA-1 was separated by 20% PAGE with 8 M urea and the amount of substrate was determined by the fluorescence intensity using Fuji Film FLA 5100 phosphoimager.</p

Atomic Models Proposed for the L-Hammerhead Ribozyme and the L-DNAzyme Interactions with their Target L-RNA2.

<p>(A) L-HHRz, 5′-U₁GGCGCUGAUGAGGCCGAAAGGCCGAAACUUGA₃₃-3' (shown in blue) with L-RNA2 target nucleotide sequence 5′-C₁UUCAAGUCCGCCA₁₄-3′ (shown in red) with the cleavage site at nucleotide C9 (shown in green), (B) L-DNAzyme 5′-G₁GCGGAGGCTAGCTACAACGATTGAAG₂₇-3′ (shown in blue) with L-RNA2 target nucleotide sequence 5′-C₁UUCAAGUCCGCCA₁₄-3′ (shown in red) with the cleavage site at nucleotide G7 (shown in green). See text for detail discussions of the models.</p

Hammerhead Spiegelzyme (34-mer) Stability in Human Blood Sera.

<p>(A) Incubation at 37°C for 0.25–120 h (6 days) in a human blood serum purchased from Sigma <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0054741#pone.0054741-Nolte1" target="_blank">[4]</a>. (B) Incubation at 37°C for 0.25–144 h in serum derived from a whole blood of a healthy blood donor. Blood was collected without anticoagulant and clotting was allowed over night at room temperature. Serum was prepared by centrifugation for 30 min at 3000 rpm in a Heraeus Megafuge 3 or at 4°C und stored in aliquots at −25°C. Serum was tested negative for HIV and hepatitis B and C by routine serological tests. (C) Control-Hammerhead ribozyme (same sequence as the Spiegelzyme) was incubated in serum (as in A) at 37°C for 0.25–120 min. All diagrams show fractions of the intact L-RNA, or D-RNA at a given time point. C-control sample was incubated on ice over time period given.</p