139 research outputs found
Recommended from our members
Equine degenerative myeloencephalopathy: prevalence, impact, and management.
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy is an inherited neurodegenerative disorder affecting many horse breeds. Clinical signs include a symmetric ataxia and an abnormal stance at rest, similar to cervical vertebral compressive myelopathy, equine protozoal myeloencephalitis, and equine herpesvirus 1 myeloencephalopathy. This review will provide an update on the disease prevalence, management, impact, and ongoing research
Ten years of the horse reference genome: insights into equine biology, domestication and population dynamics in the post-genome era.
The horse reference genome from the Thoroughbred mare Twilight has been available for a decade and, together with advances in genomics technologies, has led to unparalleled developments in equine genomics. At the core of this progress is the continuing improvement of the quality, contiguity and completeness of the reference genome, and its functional annotation. Recent achievements include the release of the next version of the reference genome (EquCab3.0) and generation of a reference sequence for the Y chromosome. Horse satellite-free centromeres provide unique models for mammalian centromere research. Despite extremely low genetic diversity of the Y chromosome, it has been possible to trace patrilines of breeds and pedigrees and show that Y variation was lost in the past approximately 2300Â years owing to selective breeding. The high-quality reference genome has led to the development of three different SNP arrays and WGSs of almost 2000 modern individual horses. The collection of WGS of hundreds of ancient horses is unique and not available for any other domestic species. These tools and resources have led to global population studies dissecting the natural history of the species and genetic makeup and ancestry of modern breeds. Most importantly, the available tools and resources, together with the discovery of functional elements, are dissecting molecular causes of a growing number of Mendelian and complex traits. The improved understanding of molecular underpinnings of various traits continues to benefit the health and performance of the horse whereas also serving as a model for complex disease across species
Recommended from our members
Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs (P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses
Recommended from our members
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed
Recommended from our members
Prevalence of the E321G MYH1 variant for immune-mediated myositis and nonexertional rhabdomyolysis in performance subgroups of American Quarter Horses.
BackgroundImmune-mediated myositis (IMM) in American Quarter Horses (QHs) causes acute muscle atrophy and lymphocytic infiltration of myofibers. Recently, an E321G mutation in a highly conserved region of the myosin heavy chain 1 (MYH1) gene was associated with susceptibility to IMM and nonexertional rhabdomyolysis.ObjectivesTo estimate prevalence of the E321G MYH1 variant in the QH breed and performance subgroups.AnimalsThree-hundred seven elite performance QHs and 146 random registered QH controls.MethodsProspective genetic survey. Elite QHs from barrel racing, cutting, halter, racing, reining, Western Pleasure, and working cow disciplines and randomly selected registered QHs were genotyped for the E321G MYH1 variant and allele frequencies were calculated.ResultsThe E321G MYH1 variant allele frequency was 0.034 ± 0.011 in the general QH population (6.8% of individuals in the breed) and the highest among the reining (0.135 ± 0.040; 24.3% of reiners), working cow (0.085 ± 0.031), and halter (0.080 ± 0.027) performance subgroups. The E321G MYH1 variant was present in cutting (0.044 ± 0.022) and Western Pleasure (0.021 ± 0.015) QHs at lower frequency and was not observed in barrel racing or racing QHs.Conclusions and clinical importanceKnowing that reining and working cow QHs have the highest prevalence of the E321G MYH1 variant and that the variant is more prevalent than the alleles for hereditary equine regional dermal asthenia and hyperkalemic periodic paralysis in the general QH population will guide the use of genetic testing for diagnostic and breeding purposes
Recommended from our members
Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models.
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcayji-hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcayji-hes mice. Additionally, supplementation of homozygous Atcayji-hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM
Successful ATAC-Seq From Snap-Frozen Equine Tissues
An assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) has become an increasingly popular method to assess genome-wide chromatin accessibility in isolated nuclei from fresh tissues. However, many biobanks contain only snap-frozen tissue samples. While ATAC-seq has been applied to frozen brain tissues in human, its applicability in a wide variety of tissues in horse remains unclear. The Functional Annotation of Animal Genome (FAANG) project is an international collaboration aimed to provide high quality functional annotation of animal genomes. The equine FAANG initiative has generated a biobank of over 80 tissues from two reference female animals and experiments to begin to characterize tissue specificity of genome function for prioritized tissues have been performed. Due to the logistics of tissue collection and storage, extracting nuclei from a large number of tissues for ATAC-seq at the time of collection is not always practical. To assess the feasibility of using stored frozen tissues for ATAC-seq and to provide a guideline for the equine FAANG project, we compared ATAC-seq results from nuclei isolated from frozen tissue to cryopreserved nuclei (CN) isolated at the time of tissue harvest in liver, a highly cellular homogenous tissue, and lamina, a relatively acellular tissue unique to the horse. We identified 20,000– 33,000 accessible chromatin regions in lamina and 22–61,000 in liver, with consistently more peaks identified using CN isolated at time of tissue collection. Our results suggest that frozen tissues are an acceptable substitute when CN are not available. For more challenging tissues such as lamina, nuclei extraction at the time of tissue collection is still preferred for optimal results. Therefore, tissue type and accessibility to intact nuclei should be considered when designing ATAC-seq experiments
- …