Registered Replication Report on Fischer, Castel, Dodd, and Pratt (2003)

The attentional spatial-numerical association of response codes (Att-SNARC) effect (Fischer, Castel, Dodd, & Pratt, 2003)—the finding that participants are quicker to detect left-side targets when the targets are preceded by small numbers and quicker to detect right-side targets when they are preceded by large numbers—has been used as evidence for embodied number representations and to support strong claims about the link between number and space (e.g., a mental number line). We attempted to replicate Experiment 2 of Fischer et al. by collecting data from 1,105 participants at 17 labs. Across all 1,105 participants and four interstimulus-interval conditions, the proportion of times the effect we observed was positive (i.e., directionally consistent with the original effect) was .50. Further, the effects we observed both within and across labs were minuscule and incompatible with those observed by Fischer et al. Given this, we conclude that we failed to replicate the effect reported by Fischer et al. In addition, our analysis of several participant-level moderators (finger-counting habits, reading and writing direction, handedness, and mathematics fluency and mathematics anxiety) revealed no substantial moderating effects. Our results indicate that the Att-SNARC effect cannot be used as evidence to support strong claims about the link between number and space

Registered replication report on Fischer, Castel, Dodd, and Pratt (2003)

The attentional spatial-numerical association of response codes (Att-SNARC) effect (Fischer, Castel, Dodd, & Pratt, 2003)—the finding that participants are quicker to detect left-side targets when the targets are preceded by small numbers and quicker to detect right-side targets when they are preceded by large numbers—has been used as evidence for embodied number representations and to support strong claims about the link between number and space (e.g., a mental number line). We attempted to replicate Experiment 2 of Fischer et al. by collecting data from 1,105 participants at 17 labs. Across all 1,105 participants and four interstimulus-interval conditions, the proportion of times the effect we observed was positive (i.e., directionally consistent with the original effect) was .50. Further, the effects we observed both within and across labs were minuscule and incompatible with those observed by Fischer et al. Given this, we conclude that we failed to replicate the effect reported by Fischer et al. In addition, our analysis of several participant-level moderators (finger-counting habits, reading and writing direction, handedness, and mathematics fluency and mathematics anxiety) revealed no substantial moderating effects. Our results indicate that the Att-SNARC effect cannot be used as evidence to support strong claims about the link between number and space

Language maintenance and language shift as strategies of social reproduction Irish in the Corca Dhuibhne Gaeltacht; 1926-1986

SIGLEAvailable from British Library Document Supply Centre-DSC:7762.45285(17) / BLDSC - British Library Document Supply CentreGBUnited Kingdo

Binding site asymmetry in human transthyretin: insights from a joint neutron and X-ray crystallographic analysis using perdeuterated protein

Human transthyretin has an intrinsic tendency to form amyloid fibrils and is heavily implicated in senile systemic amyloidosis. Here, detailed neutron structural studies of perdeuterated transthyretin are described. The analyses, which fully exploit the enhanced visibility of isotopically replaced hydrogen atoms, yield new information on the stability of the protein and the possible mechanisms of amyloid formation. Residue Ser117 may play a pivotal role in that a single water molecule is closely associated with the γ-hydrogen atoms in one of the binding pockets, and could be important in determining which of the two sites is available to the substrate. The hydrogen-bond network at the monomer–monomer interface is more extensive than that at the dimer–dimer interface. Additionally, the edge strands of the primary dimer are seen to be favourable for continuation of the β-sheet and the formation of an extended cross-β structure through sequential dimer couplings. It is argued that the precursor to fibril formation is the dimeric form of the protein

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction

A molecular mechanism for transthyretin amyloidogenesis

A number of disease-causing human transthyretin (TTR) mutations are known to lead to amyloid formation. Here the authors combine neutron crystallography, native mass spectrometry and modelling studies to characterize the T119M and S52P-TTR mutants, providing mechanistic insights into TTR amyloidosis