Risk Analysis of Chemical Plant Explosion Accidents Based on Bayesian Network

Many chemical plant explosion accidents occur along with the development of the chemical industry. Meanwhile, the interaction and influence of various factors significantly increase the uncertainty of the evolution process of such accidents. This paper presents a framework to dynamically evaluate chemical plant explosion accidents. We propose twelve nodes to represent accident evolution and establish a Bayesian network model for chemical plant explosion accidents, combining historical data with expert experience to support the prevention, management, and real-time warning. Hypothetical scenarios and catastrophic explosion scenarios were analyzed by setting different combinations of states for nodes. Moreover, the impacts of factors such as factory type, material form, accident equipment, the emergency response on casualty and property loss are evaluated. We find that sensitivity of property loss and casualties to factory type and ongoing work are less significant; the equipment factors result in more casualties than that from personnel factors; the impact of emergency response on the accident results is significant; equipment safety management and personnel safety training are the most important measures to prevent chemical plant explosion risks

A Hypoxia-Related lncRNA Signature Correlates with Survival and Tumor Microenvironment in Colorectal Cancer

The hypoxic tumor microenvironment and long noncoding RNAs (lncRNAs) are pivotal in cancer progression and correlate with the survival outcome of patients. However, the role of hypoxia-related lncRNAs (HRLs) in colorectal cancer (CRC) development remains largely unknown. Herein, we developed a hypoxia-related lncRNA signature to predict patients’ survival and immune infiltration. The RNA-sequencing data of 500 CRC patients were obtained from The Cancer Genome Atlas (TCGA) dataset, and HRLs were selected using Pearson’s analysis. Next, the Cox regression analysis was applied to construct a risk signature consisting of 9 HRLs. This signature could predict the overall survival (OS) of CRC patients with high accuracy in training, validation, and entire cohort. This signature was an independent risk factor and exerted predictive ability in different subgroups. Functional analysis revealed different molecular features between high- and low-risk groups. A series of drugs including cisplatin showed different sensitivities between the two groups. The expression pattern of immune checkpoints was also distinct between the two clusters in this model. Furthermore, the high-risk group had higher immune, stromal, and ESTIMATE score and a more repressive immune microenvironment than the low-risk group. Moreover, MYOSLID, one of the lncRNAs in this signature, could significantly regulate the proliferation, invasion, and metastasis of CRC

Submersed macrophytes Vallisneria natans and Vallisneria spinulosa improve water quality and affect microbial communities in sediment and water columns

Healthy aquatic ecosystems are essential for human beings. However, anthropogenic activities severely worsen water quality. In this study, using assembling mesocosms, we developed an efficient and easy-to-handle method to monitor the water quality by measuring the electrical conductivity (EC) of water. Our data demonstrate that the growth of two submersed macrophytes, Vallisneria natans and Vallisneria spinulosa, improves water quality by decreasing EC. Furthermore, using high-throughput DNA sequencing, we analyzed the microbial community abundance and structure in sediment and water columns with or without plant growth. We generated 33,775 amplicon sequence variants from 69 samples of four sediment groups (BkM, CtM, VnR, and VsR) and three water column sample groups (CtW, VnW, and VsW). The results show that the relative abundance of bacteria was higher in the sediment than in the water column. Moreover, the diversity and composition of microbiomes were altered by Vallisneria spp. growth, and the α-diversity of the microbial communities decreased due to submersed macrophytes in both the sediment and water columns. The β-diversity of the microbial communities also varied significantly with or without Vallisneria spp. growth for both the sediment and water columns

Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus

In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes

Integrative Analysis of the Wheat PHT1 Gene Family Reveals A Novel Member Involved in Arbuscular Mycorrhizal Phosphate Transport and Immunity

Phosphorus (P) deficiency is one of the main growth-limiting factors for plants. However, arbuscular mycorrhizal (AM) symbiosis can significantly promote P uptake. Generally, PHT1 transporters play key roles in plants’ P uptake, and thus, PHT1 genes have been investigated in some plants, but the regulation and functions of these genes in wheat (TaPHT1) during AM symbiosis have not been studied in depth. Therefore, a comprehensive analysis of TaPHT1 genes was performed, including sequence, phylogeny, cis-elements, expression, subcellular localization and functions, to elucidate their roles in AM-associated phosphate transport and immunity. In total, 35 TaPHT1s were identified in the latest high-quality bread wheat genome, 34 of which were unevenly distributed on 13 chromosomes, and divided into five groups. Sequence analysis indicated that there are 11 types of motif architectures and five types of exon-intron structures in the TaPHT1 family. Duplication mode analysis indicated that the TaPHT1 family has expanded mainly through segmental and tandem duplication events, and that all duplicated gene pairs have been under purifying selection. Transcription analysis of the 35 TaPHT1s revealed that not only known the mycorrhizal-specific genes TaPht-myc, TaPT15-4B (TaPT11) and TaPT19-4D (TaPT10), but also four novel mycorrhizal-specific/inducible genes (TaPT3-2D, TaPT11-4A, TaPT29-6A, and TaPT31-7A) are highly up-regulated in AM wheat roots. Furthermore, the mycorrhizal-specific/inducible genes are significantly induced in wheat roots at different stages of infection by colonizing fungi. Transient Agrobacterium tumefaciens-mediated transformation expression in onion epidermal cells showed that TaPT29-6A is a membrane-localized protein. In contrast to other AM-specific/inducible PHT1 genes, TaPT29-6A is apparently required for the symbiotic and direct Pi pathway. TaPT29-6A-silenced lines exhibited reduced levels of AM fungal colonization and arbuscules, but increased susceptibility to biotrophic, hemi-biotrophic and necrotrophic pathogens. In conclusion, TaPT29-6A was not only essential for the AM symbiosis, but also played vital roles in immunity

HvWRKY2 acts as an immunity suppressor and targets HvCEBiP to regulate powdery mildew resistance in barley

Plants use a sophisticated immune system to perceive pathogen infection and activate immune responses in a tightly controlled manner. In barley, HvWRKY2 acts as a repressor in barley disease resistance to the powdery mildew fungus, Blumeria graminis f. sp. hordei (Bgh). However, the molecular features of HvWRKY2 in its DNA-binding and repressor functions, as well as its target genes, are uncharacterized. We show that the W-box binding of HvWRKY2 requires an intact WRKY domain and an upstream sequence of ∼75 amino acids, and the HvWRKY2 W-box binding activity is linked to its repressor function in disease resistance. Chromatin immunoprecipitation (ChIP)-seq analysis identified HvCEBiP, a putative chitin receptor gene, as a target gene of HvWRKY2 in overexpressing transgenic barley plants. ChIP-qPCR and Electrophoretic Mobility Shift Assay (EMSA) verified the direct binding of HvWRKY2 to a W-box-containing sequence in the HvCEBiP promoter. HvCEBiP positively regulates resistance against Bgh in barley. Our findings suggest that HvWRKY2 represses barley basal immunity by directly targeting pathogen-associated molecular pattern (PAMP) recognition receptor genes, suggesting that HvCEBiP and likely chitin signaling function in barley PAMP-triggered immune responses to Bgh infection

Development of a highly metastatic model that reveals a crucial role of fibronectin in lung cancer cell migration and invasion

<p>Abstract</p> <p>Background</p> <p>The formation of metastasis is the most common cause of death in patients with lung cancer. A major implement to understand the molecular mechanisms involved in lung cancer metastasis has been the lack of suitable models to address it. In this study, we aimed at establishing a highly metastatic model of human lung cancer and characterizing its metastatic properties and underlying mechanisms.</p> <p>Methods</p> <p>The human lung adeno-carcinoma SPC-A-1 cell line was used as parental cells for developing of highly metastatic cells by <it>in vivo </it>selection in NOD/SCID mice. After three rounds of selection, a new SPC-A-1sci cell line was established from pulmonary metastatic lesions. Subsequently, the metastatic properties of this cell line were analyzed, including optical imaging of <it>in vivo </it>metastasis, immunofluorescence and immunohistochemical analysis of several epithelial mesenchymal transition (EMT) makers and trans-well migration and invasion assays. Finally, the functional roles of fibronectin in the invasive and metastatic potentials of SPC-A-1sci cells were determined by shRNA analysis.</p> <p>Results</p> <p>A spontaneously pulmonary metastatic model of human lung adeno-carcinoma was established in NOD/SCID mice, from which a new lung cancer cell line, designated SPC-A-1sci, was isolated. Initially, the highly metastatic behavior of this cell line was validated by optical imaging in mice models. Further analyses showed that this cell line exhibit phenotypic and molecular alterations consistent with EMT. Compared with its parent cell line SPC-A-1, SPC-A-1sci was more aggressive <it>in vitro</it>, including increased potentials for cell spreading, migration and invasion. Importantly, fibronectin, a mesenchymal maker of EMT, was found to be highly expressed in SPC-A-1sci cells and down-regulation of it can decrease the <it>in vitro </it>and <it>in vivo </it>metastatic abilities of this cell line.</p> <p>Conclusions</p> <p>We have successfully established a new human lung cancer cell line with highly metastatic potentials, which is subject to EMT and possibly mediated by increased fibronectin expression. This cell line and its reproducible <it>s.c</it>. mouse model can further be used to identify underlying mechanisms of lung cancer metastasis.</p