Engineering HIV-Resistant Human CD4+ T Cells with CXCR4-Specific Zinc-Finger Nucleases

HIV-1 entry requires the cell surface expression of CD4 and either the CCR5 or CXCR4 coreceptors on host cells. Individuals homozygous for the ccr5Δ32 polymorphism do not express CCR5 and are protected from infection by CCR5-tropic (R5) virus strains. As an approach to inactivating CCR5, we introduced CCR5-specific zinc-finger nucleases into human CD4+ T cells prior to adoptive transfer, but the need to protect cells from virus strains that use CXCR4 (X4) in place of or in addition to CCR5 (R5X4) remains. Here we describe engineering a pair of zinc finger nucleases that, when introduced into human T cells, efficiently disrupt cxcr4 by cleavage and error-prone non-homologous DNA end-joining. The resulting cells proliferated normally and were resistant to infection by X4-tropic HIV-1 strains. CXCR4 could also be inactivated in ccr5Δ32 CD4+ T cells, and we show that such cells were resistant to all strains of HIV-1 tested. Loss of CXCR4 also provided protection from X4 HIV-1 in a humanized mouse model, though this protection was lost over time due to the emergence of R5-tropic viral mutants. These data suggest that CXCR4-specific ZFNs may prove useful in establishing resistance to CXCR4-tropic HIV for autologous transplant in HIV-infected individuals

Microarray analysis and scale-free gene networks identify candidate regulators in drought-stressed roots of loblolly pine (P. taeda L.)

<p>Abstract</p> <p>Background</p> <p>Global transcriptional analysis of loblolly pine (<it>Pinus taeda </it>L.) is challenging due to limited molecular tools. PtGen2, a 26,496 feature cDNA microarray, was fabricated and used to assess drought-induced gene expression in loblolly pine propagule roots. Statistical analysis of differential expression and weighted gene correlation network analysis were used to identify drought-responsive genes and further characterize the molecular basis of drought tolerance in loblolly pine.</p> <p>Results</p> <p>Microarrays were used to interrogate root cDNA populations obtained from 12 genotype × treatment combinations (four genotypes, three watering regimes). Comparison of drought-stressed roots with roots from the control treatment identified 2445 genes displaying at least a 1.5-fold expression difference (false discovery rate = 0.01). Genes commonly associated with drought response in pine and other plant species, as well as a number of abiotic and biotic stress-related genes, were up-regulated in drought-stressed roots. Only 76 genes were identified as differentially expressed in drought-recovered roots, indicating that the transcript population can return to the pre-drought state within 48 hours. Gene correlation analysis predicts a scale-free network topology and identifies eleven co-expression modules that ranged in size from 34 to 938 members. Network topological parameters identified a number of central nodes (hubs) including those with significant homology (E-values ≤ 2 × 10^-30) to 9-cis-epoxycarotenoid dioxygenase, zeatin O-glucosyltransferase, and ABA-responsive protein. Identified hubs also include genes that have been associated previously with osmotic stress, phytohormones, enzymes that detoxify reactive oxygen species, and several genes of unknown function.</p> <p>Conclusion</p> <p>PtGen2 was used to evaluate transcriptome responses in loblolly pine and was leveraged to identify 2445 differentially expressed genes responding to severe drought stress in roots. Many of the genes identified are known to be up-regulated in response to osmotic stress in pine and other plant species and encode proteins involved in both signal transduction and stress tolerance. Gene expression levels returned to control values within a 48-hour recovery period in all but 76 transcripts. Correlation network analysis indicates a scale-free network topology for the pine root transcriptome and identifies central nodes that may serve as drivers of drought-responsive transcriptome dynamics in the roots of loblolly pine.</p

Decoding the massive genome of loblolly pine using haploid DNA and novel assembly strategies

BACKGROUND: The size and complexity of conifer genomes has, until now, prevented full genome sequencing and assembly. The large research community and economic importance of loblolly pine, Pinus taeda L., made it an early candidate for reference sequence determination. RESULTS: We develop a novel strategy to sequence the genome of loblolly pine that combines unique aspects of pine reproductive biology and genome assembly methodology. We use a whole genome shotgun approach relying primarily on next generation sequence generated from a single haploid seed megagametophyte from a loblolly pine tree, 20-1010, that has been used in industrial forest tree breeding. The resulting sequence and assembly was used to generate a draft genome spanning 23.2 Gbp and containing 20.1 Gbp with an N50 scaffold size of 66.9 kbp, making it a significant improvement over available conifer genomes. The long scaffold lengths allow the annotation of 50,172 gene models with intron lengths averaging over 2.7 kbp and sometimes exceeding 100 kbp in length. Analysis of orthologous gene sets identifies gene families that may be unique to conifers. We further characterize and expand the existing repeat library based on the de novo analysis of the repetitive content, estimated to encompass 82% of the genome. CONCLUSIONS: In addition to its value as a resource for researchers and breeders, the loblolly pine genome sequence and assembly reported here demonstrates a novel approach to sequencing the large and complex genomes of this important group of plants that can now be widely applied

ConiferEST: an integrated bioinformatics system for data reprocessing and mining of conifer expressed sequence tags (ESTs)-2

<p><b>Copyright information:</b></p><p>Taken from "ConiferEST: an integrated bioinformatics system for data reprocessing and mining of conifer expressed sequence tags (ESTs)"</p><p>BMC Genomics 2007;8():134-134.</p><p>Published online 29 May 2007</p><p>PMCID:PMC1894976.</p><p></p> individual sequences, users first select the ConiferEST option within the pull-down menu shown in the top portion. Users then enter either the specific sequence name (., FLD1_34_H08.g1_A029), GenBank accession (., CO162374), or GenBank gi number (., 48932915), and click the button. : After choosing one or more libraries from the expandable tree shown in Panel A, the database query interface provides users three options, one of which is "Sequences with putative features". As shown, there is a variety of data filters that can be applied to retrieve putative feature data in terms of users' needs. : The second option is "Sequences with verified features". Users can not only specify sequences with or without certain verified termini, but also require specific length for verified polyA and/or polyT tails. : The third option is "Sequence with InterproScan annotation". Users can choose among different InterPro Member databases. They can also conduct advanced field search by text pattern matching. : Clicking the button shown in the Panel D returns the sortable, tabulated InterProScan results from the database

ConiferEST: an integrated bioinformatics system for data reprocessing and mining of conifer expressed sequence tags (ESTs)-1

<p><b>Copyright information:</b></p><p>Taken from "ConiferEST: an integrated bioinformatics system for data reprocessing and mining of conifer expressed sequence tags (ESTs)"</p><p>BMC Genomics 2007;8():134-134.</p><p>Published online 29 May 2007</p><p>PMCID:PMC1894976.</p><p></p>OLD1_10_H04.b1_A029 is a 3'-end sequence with a verified 5' terminus in NS (or 3' terminus in SS in reverse complementary view) and "double-termini adapters". Its 5' counterpart, COLD1_10_H04.g1_A029, also has "double-termini adapters" and a detectable polyA tail. . Like , provides users many options for customizing their sequence views but focuses on verified features. For a given sequence, checking the box within the and then clicking button, highlights with a red background the final sequence, which can then be directed to other search tools or cut-and-pasted into other applications. RTNACL1_14_G12.g1_A029 is a 5'-end sequence without any verified terminus. The last 28 bases (.., AAATAAATGGCGACTGTATGTGGACGAC, the bases with black background) of its final sequence have been manually highlighted with the cursor for illustration purpose. . Clicking the menu item displayed when the link in is selected, pops-up the relevant Gene Index cluster view. As shown, all three above-mentioned sequences are found in cluster TC65773, where COLD1_10_H04.g1_A029 is labelled as "", COLD1_10_H04.b1_A029 as "", and RTNACL_14_G12.g1_A029 as "" within the cluster alignment graph. To verify the alignment, we found the last 28 bases of RTNACL1_14_G12.g1_A029 were located from 867 to 894 in COLD1_10_H04.b1_A029 (reverse complement) and from 635 to 662 in COLD1_10_H04.g1_A029. It appears that the whole cluster obtains about 300 extra bases in its 3' end because of the double-termini adapters. . By clicking the menu item available after the link in is selected, the final sequence for a given sequence read will be dynamically sent out for open reading frame detection. As shown, RTNACL1_14_G12.g1_A029 displays 6-frame ORF results. If available, the user can follow the menu item that appears when the link is selected to explore relevant protein signatures of the InterPro member databases