Willy Clarysse & Ana I. Blasco Torres (eds), Egyptian Language in Greek Sources : Scripta Onomastica of Jan Quaegebeur [Book review]

Non peer reviewe

Variation within and among Writing Systems: Concepts and Methods in the Analysis of Ancient Written Documents. Edited by Paola Cotticelli-Kurras – Alfredo Rizza. LautSchriftSprache / ScriptandSound 1. Dr. Ludwig Reichert Verlag, Wiesbaden 2017. [Book review]

Non peer reviewe

The system of Coptic vowel reduction : Evidence from L2 Greek usage

In this paper I study Coptic vowel reduction through L2 Greek misspellings in Egypt from the Roman period onwards. Greek was the language of the government with mostly Egyptian scribes. In many cases, it is obvious that the nonstandard vowel replacements in Greek result from the Coptic tendency to reduce the quality of unstressed vowels to schwa. L2 Greek misspellings offer a glimpse into the system of vowel reduction in Coptic, evidence of which is not easily obtained language-internally. The misspellings are congruent with phoneme distribution in Coptic and can be verified by similar misspellings of Greek loanwords in native Coptic texts. Observed phenomena are the reduction of unstressed word-final vowels to schwa, stress-conditioned allophonic variation in round vowels, and consonant-to-vowel coarticulation word-medially.Peer reviewe

Tapaluokan vai foneemin sekaannus? L1 fonologian vaikutus verbin semantiikkaan

Abstract: The Greek texts from Egypt show extensive nonstandard vowel production, which could cause inadvertent confusion in e.g. Greek mood or case endings.This has previously been seen as evidence of a bad command of Greek, either because of internal phonological change or due to imperfect knowledge of Greek. On closer look numerous similarities to the nonstandard vowel production in Greek texts can also be found in native (Coptic) Egyptian texts. Greek loanwords in Coptic are treated according to Coptic phonological rules and show nonstandard vowel usage of the same nature that is present in Greek in some sociolects. The nonstandard spellings present evidence of underdifferentiation of Greek phonemes as well as transfer elements of the Egyptian prosodic system. The vowel usage is examined within the framework of L2WS (second language writing systems) studies, and evidence for the coarticulatory effect of the consonants on the vowels’ quality is drawn from the field of articulatory phonetics. Keywords: Ancient Greek phonology, Ancient Greek modality, Postclassical Greek, Coptic phonology, Language contactThe Greek texts from Egypt show extensive nonstandard vowel production, which could cause inadvertent confusion in e.g. Greek mood or case endings.This has previously been seen as evidence of a bad command of Greek, either because of internal phonological change or due to imperfect knowledge of Greek. On closer look numerous similarities to the nonstandard vowel production in Greek texts can also be found in native (Coptic) Egyptian texts. Greek loanwords in Coptic are treated according to Coptic phonological rules and show nonstandard vowel usage of the same nature that is present in Greek in some sociolects. The nonstandard spellings present evidence of underdifferentiation of Greek phonemes as well as transfer elements of the Egyptian prosodic system. The vowel usage is examined within the framework of L2WS (second language writing systems) studies, and evidence for the coarticulatory effect of the consonants on the vowels’ quality is drawn from the field of articulatory phonetics.Peer reviewe

/r/ from Äännekoulu? : Families' experiences of an internet site designed for improving articulation errors at home

Objectives: 18 percent of Finnish children have some kind of articulation problems when starting their school path. Lack of speech therapists and unequal spread of these professionals has reduced possibility to receive speech therapy for mild problems. Instead resources are allocated for clients with severe speech and language disorders. In some municipalities parents and special education teachers are already responsible for the remediation of articulation problems. The aim of this study was to identify if Äännekoulu-website (www.aannekoulu.fi) can help to rehabilitate articulation problems and if the site will meet the needs of the parents struggling with their children' articulation problem. Methods: The study was qualitatively centred mixed method design that had also some quantitative elements. 21 children between the ages of 5 and 7 with /r/ articulation problem participated in this study. Children were tested three times. Children's spontaneous development of /r/ was controlled by having one month break after the first testing. After the second test families received the right to use Äännekoulu practice materials. Families were instructed to use the site for two months just as regular paying customers would do. Outcome of the intervention was observed during the third test. Families were also given a phone call after one and a half months of the last test to explore the possible changes in the /r/ articulation. In addition families were asked to keep a record of their home practices and answer in a survey concerning the Äännekoulu intervention period. Results and conclusions: Six families dropped out from the intervention. Five children found the right /r/ spontaneously. 12 families participated in the remediation period and one child found the missing /r/. Nine children had no changes in their articulation. From these nine children three continued their practice after the real intervention. During one month of practice two out of these three children found the /r/ completely and one learned to do long /r/-vibration. Families didn't practice a lot and they were unsatisfied with the amount of practice. According to the parents health issues within the family, burdensome family situations, lack of time, child's unwillingness to complete assignments, technical difficulties and laziness were the biggest barriers for practicing. Families considered Äännekoulu to be a good way to practice. Families were pleased about the nice games and the possibility to practise whenever and wherever since the exercises were available online. Unfortunately families trained impractically without knowing it and actually reinforced the incorrect articulation. Parents thought that the visual look of Äännekoulu should be revised and some of them also longed for more diverse games. Still the most crucial target for development in Äännekoulu is the instructions of the assignments. The model of the site hasn't been clear to the users even though families didn't consider the website to be confusing. It's clear that the the instructions have been insufficient since only one family realised how to progress accordingly. On the basis of this study it can be stated that speech therapist's guidance is significant when rehabilitating articulation problems. In the future it would be beneficial to explore, what kind of home instructions help families to execute their role in a best way possible, what is the role of a speech therapist in the future especially when considering telepractice or other technological services and can Äännekoulu fulfill the gap in the field of articulation remediation.Tavoitteet: Kouluaan aloittavista lapsista noin 18 prosentilla on äännevirheitä. Puheterapiaresurssien riittämättömyys ja epätasainen jakautuminen ovat aiheuttaneet sen, että puheterapiamäärät ovat vähentyneet monissa kunnissa ja lievimmät häiriöt jäävät jopa kokonaan hoitamatta. Artikulaatiovirheiden korjaaminen onkin jo paikoittain siirtynyt vanhempien ja erityisopettajien vastuulle. Tämän tutkielman tarkoituksena oli selvittää voisiko Äännekoulu-sivusto (www.aannekoulu.fi) vastata niihin tarpeisiin, joita äännevirheisten lasten vanhemmat kohtaavat, ja auttaako sivusto äänteen kuntouttamisessa. Äännekoulun avulla perheet voivat harjoitella kotona lasten puuttuvaa äännettä puheterapeutin suunnittelemilla ohjeilla ja tehtävillä. Menetelmät: Tutkimus oli laadullisesti painottuva monimenetelmäinen tutkimus, joka sisälsi myös määrällistä aineistoa. Tutkimukseen osallistui 21 5–7-vuotiasta lasta, joilla oli r-äännevirhe. Lapsia tavattiin kolme kertaa: alku-baseline -tutkimuksessa, alkutestauksessa ja lopputestauksessa. Spontaania äänteen oppimista kontrolloitiin alku-baselinen jälkeen pidetyllä kuukauden tauolla. Alkutestauksen jälkeen perheet saivat kahden kuukauden käyttöoikeuden Äännekoulun /r/-materiaaleihin. Perheet toteuttivat harjoittelua samalla tavoin kuin Äännekoulun muutkin asiakkaat. Harjoittelun tuloksellisuutta tarkasteltiin lopputestauksessa. Äänteen mahdollisia muutoksia kartoitettiin vielä soittamalla perheisiin puolentoista kuukauden kuluttua lopputestauksesta. Perheitä pyydettiin myös pitämään kirjaa kotiharjoitteluistaan sekä vastaamaan harjoittelujakson jälkeen kyselyyn, jossa kartoitetiin harjoittelun sujuvuutta, harjoittelua edistäneitä ja jarruttaneita asioita sekä Äännekoulun toimivuutta. Tulokset ja johtopäätökset: Tutkittavista perheistä kuusi jättäytyi pois harjoittelujaksolta ja viiden lapsen /r/ löytyi spontaanisti ilman harjoittelua. Harjoittelujaksolle osallistuneista 12 perheestä yhden lapsi löysi /r/:n täryn harjoittelujakson aikana. Yhdeksän lapsen äänteessä ei tapahtunut muutosta. Näistä yhdeksästä kolme jatkoi harjoittelua vielä varsinaisen harjoittelujakson jälkeen Äännekoulun avulla. Heistä kaksi oppi kuukauden aikana /r/:n kokonaan ja yksi oppi pitkän /r/:n täryn. Harjoittelujaksolle osallistuneet perheet olivat yleisesti tyytymättömiä harjoittelumääriinsä ja harjoittelivatkin melko vähän. Harjoittelua vähensivät lapsen ja muiden perheenjäsenten sairastumiset, kuormittavat perhetilanteet, ajanpuute, lapsen haluttomuus tehdä tehtäviä, tekniset hankaluudet sekä laiskuus. Perheet itse pitivät Äännekoulua hyvänä harjoittelumuotona, mutta etenivät harjoittelussaan tietämättään epätarkoituksenmukaisesti ja vahvistivat vahingossa lastensa virheellistä äännettä. Erityistä kiitosta sivusto sai kivoista peleistä sekä siitä, että harjoittelu tapahtui internetin kautta, jolloin se ei ollut aikaan tai paikkaan sidottua. Kehitettävää vanhemmat löysivät erityisesti Äännekoulun visuaalisesta ilmeestä ja muutamat perheet kaipasivat myös monipuolisempia pelejä. Äännekoulun suurin kehityskohta oli kuitenkin tehtävien ohjeistuksissa. Vaikka perheet eivät kokeneet yksittäisiä tehtäväohjeistuksia epäselvinä, sivuston etenemismalli oli jäänyt vanhemmille vieraaksi. Koska vain yksi perhe oli harjoitellut tehtäviä tarkoituksenmukaisella tavalla, on selvää, että ohjeistukset olivat olleet perheiden tarpeisiin riittämättömät. Tulosten perusteella voidaan myös todeta, että puheterapeutin antamalla ohjauksella oli merkittävä rooli äänteen kuntoutumisessa. Jatkossa olisikin hyvä tutkia, millaiset kotiohjeistukset auttavat perheitä parhaiten toteuttamaan kuntoutustehtäväänsä, mikä on puheterapeutin tulevaisuuden rooli erityisesti etäkuntoutuksen kentällä ja voiko Äännekoulu täyttää kuntoutuskentällä olevaa aukkoa äännevirheiden kuntouttamisessa

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcayji-hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcayji-hes mice. Additionally, supplementation of homozygous Atcayji-hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM

EASY LANGUAGE FOR THE L2 FINNISH LEARNER : EASY ADMINISTRATIVE TEXTS FOR ALL

Tässä artikkelissa tutkin maahanmuuttajille suunnatun viranomaistiedon antamista selkokielisessä muodossa. Aineistoni on peräisin selkomukautetun Perustietoa Suomesta -oppaan valmisteluprosessista, jossa S2-oppijat testasivat oppaaseen tulevien tekstien rakenteita. Opas suunniteltiin maahanmuuttajille, ja siihen koottiin tarpeellista tietoa Suomen hallinnosta ja yhteiskunnasta. Testatessa selvisi, että monet äidinkielisille käyttäjille tarkoitetut selkokielen rakenteet ovat maahanmuuttajataustaisille koelukijoille vaikeita, ja että S2-oppijat tarvitsevat tietyiltä osin omanlaistaan selkokieltä. Kielen rakenteisiin liittyvien haasteiden lisäksi tutkimuksessa nousi esiin muitakin viranomaistiedon jakamiseen liittyviä kysymyksiä, kuten kulttuurikohtaisen sanaston väärinymmärtäminen. -------- In this article I study administrative information given to immigrants that is written in an easy format. The material I use comes from the working process of the Life in Finland guide, which has been translated into easy Finnish. The structures of the texts planned for the guide, designed for immigrants and containing essential information on the Finnish government and society, were tested by second language (L2) Finnish learners. Testing revealed that many of the easy language structures designed for native language (L1) users were difficult for test readers with an L2/immigrant background. It became obvious that to some extent, L2 Finnish learners need an easy language form of their own. In addition to the challenges related to linguistic structures, the study also raised questions related to the distribution of administrative information; one of which was the misunderstanding of culture-specific vocabulary.In this article I study administrative information given to immigrants that is written in an easy format. The material I use comes from the working process of the Life in Finland guide, which has been translated into easy Finnish. The structures of the texts planned for the guide, designed for immigrants and containing essential information on the Finnish government and society, were tested by second language (L2) Finnish learners. Testing revealed that many of the easy language structures designed for native language (L1) users were difficult for test readers with an L2/immigrant background. It became obvious that to some extent, L2 Finnish learners need an easy language form of their own. In addition to the challenges related to linguistic structures, the study also raised questions related to the distribution of administrative information; one of which was the misunderstanding of culture-specific vocabulary.Peer reviewe

Neutrophil Secretion Induced by an Intracellular Ca(2+) Rise and Followed by Whole-Cell Patch-Clamp Recordings Occurs Without any Selective Mobilization of Different Granule Populations

We have investigated calcium-induced secretion in human neutrophils, using a whole-cell patch-clamp technique. Mobilization of subcellular granules to the cell membrane was followed as the change in membrane capacitance (ΔC(m)). Both the magnitude and the kinetics of the response differed between low and high concentrations of Ca(2+). A sustained secretion following a short lag phase was induced by high concentrations of Ca(2+) (100 μM and higher). A stable plateau was reached after 5–7 minutes at ΔC(m) values corresponding to values expected after all specific as well as azurophil granules have been mobilized. Capacitance values of the same magnitude could be obtained also at lower Ca(2+) concentrations, but typically no stable plateau was reached within the measuring time. In contrast to previous studies, we were unable to detect any pattern of secretion corresponding to a distinct submaximal response or selective mobilization of granule subsets specified by their Ca(2+)-sensitivity

Impact of alpha-tocopherol deficiency and supplementation on sacrocaudalis and gluteal muscle fiber histopathology and morphology in horses.

BackgroundA subset of horses deficient in alpha-tocopherol (α-TP) develop muscle atrophy and vitamin E-responsive myopathy (VEM) characterized by mitochondrial alterations in the sacrocaudalis dorsalis medialis muscle (SC).ObjectivesTo quantify muscle histopathologic abnormalities in subclinical α-TP deficient horses before and after α-TP supplementation and compare with retrospective (r)VEM cases.AnimalsProspective study; 16 healthy α-TP-deficient Quarter Horses. Retrospective study; 10 retrospective vitamin E-responsive myopathy (rVEM) cases .MethodsBlood, SC, and gluteus medius (GM) biopsy specimens were obtained before (day 0) and 56 days after 5000 IU/450 kg horse/day PO water dispersible liquid α-TP (n = 8) or control (n = 8). Muscle fiber morphology and mitochondrial alterations were compared in samples from days 0 and 56 and in rVEM cases.ResultsMitochondrial alterations more common than our reference range (<2.5% affected fibers) were present in 3/8 control and 4/8 treatment horses on day 0 in SC but not in GM (mean, 2.2; range, 0%-10% of fibers). Supplementation with α-TP for 56 days did not change the percentage of fibers with mitochondrial alterations or anguloid atrophy, or fiber size in GM or SC. Clinical rVEM horses had significantly more mitochondrial alterations (rVEM SC, 13% ± 7%; GM, 3% ± 2%) and anguloid atrophy compared to subclinical day 0 horses.Conclusions and clinical importanceClinically normal α-TP-deficient horses can have mitochondrial alterations in the SC that are less severe than in atrophied VEM cases and do not resolve after 56 days of α-TP supplementation. Preventing α-TP deficiency may be of long-term importance for mitochondrial viability