943 research outputs found
The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis
The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos
The ATF6-Met [67] Val substitution is associated with increased plasma cholesterol levels
Objective— Activating transcription factor 6 (ATF6) is a sensor of the endoplasmic reticulum stress response and regulates expression of several key lipogenic genes. We used a 2-stage design to investigate whether ATF6 polymorphisms are associated with lipids in subjects at increased risk for cardiovascular disease (CVD). Methods and Results— In stage 1, 13 tag-SNPs were tested for association in Dutch samples ascertained for familial combined hyperlipidemia (FCHL) or increased risk for CVD (CVR). In stage 2, we further investigated the SNP with the strongest association from stage 1, a Methionine/Valine substitution at amino-acid 67, in Finnish FCHL families and in subjects with CVR from METSIM, a Finnish population-based cohort. The combined analysis of both stages reached region-wide significance (P=9x10–4), but this association was not seen in the entire METSIM cohort. Our functional analysis demonstrated that Valine at position 67 augments ATF6 protein and its targets Grp78 and Grp94 as well as increases luciferase expression through Grp78 promoter. Conclusions— A common nonsynonymous variant in ATF6 increases ATF6 protein levels and is associated with cholesterol levels in subjects at increased risk for CVD, but this association was not seen in a population-based cohort. Further replication is needed to confirm the role of this variant in lipids. We report the association of the ATF6-methionine [67]valine amino-acid substitution with plasma cholesterol levels. Association analyses in 2674 subjects and functional data suggest that the ATF6 gene may influence cholesterol levels in subjects at increased risk to develop cardiovascular disease
The renewable energy and energy efficiency potential of Waitakere City : a thesis presented in partial fulfilment of the requirements for the degree of Masters of Technology in Energy Management at Massey University
Electricity restrictions and blackouts have occurred in Waitakere City in the past and are likely to occur again in the future unless the city can become more self reliant by meeting, at least in part, the increasing energy requirements for what is one of the fastest growing cities in New Zealand. In this study the potentials for energy conservation, energy efficiency and renewable energy resources have been broadly quantified and assessed using desktop analysis of publicly available data for stationary final use energy systems (i.e. excluding transportation) within the geographical area of Waitakere City and adjoining waters.
It was found that energy efficiency and energy conservation measures can consistently and predictably achieve overall energy savings and reduce daily and seasonal peak demand.
The best renewable energy resource potential exists with solar and geothermal for heating applications and wave, offshore and inshore wind and tidal currents for electricity generation. There is very limited potential for hydro and bioenergy systems beyond what already exists. PV solar and land based wind power generation are currently only feasible for limited off-grid applications.
This scoping study confirms the achievability of the vision expressed in Waitakere City Council's "Long Term Council Community Plan" (LTCCP) that by 2020 " Waitakere City will be an energy cell, not an energy sink. Air quality supports good health". A range of flagship projects have been identified to progress the achievement of this vision. Waitakere City Council can use this report as part of the development of a comprehensive energy management plan
Continuing smoking between adolescence and young adulthood is associated with higher arterial stiffness in young adults: the Northern Ireland Young Hearts Project
Objectives To investigate the associations between smoking in adolescence and adulthood, and changes in smoking behaviour between these age periods, with arterial stiffness in young adults; and whether any such associations could be explained by concomitant smoking-related levels of inflammation and endothelial dysfunction.Methods We studied 424 individuals (216 women) in whom smoking status was assessed in adolescence (age 15 years) and again in young adulthood (mean age of 22.6 ± 1.6 years), along with aorto-iliac, aorto-radial, and aorto-dorsalis pedis pulse wave velocity (PWV), and markers of inflammation (i.e. C-reactive protein and fibrinogen) and endothelial dysfunction (i.e. von Willebrand factor and tissue-plasminogen activator antigen) in young adulthood only.Results Smoking in adolescence was associated with higher aorto-iliac PWV, as well as with inflammation and endothelial dysfunction levels (expressed as two scores), independently of other adolescent and adult lifestyles. Compared with never smokers, continuing smokers, but not starters nor quitters, showed higher aorto-iliac PWV, independent of changes in other lifestyle variables: +0.157 m/s (95% confidence interval 0.026–0.288). This difference was attenuated to 0.124 m/s (−0.009 to 0.257) after adjustment for changes in traditional biological risk factors, but was not materially affected when adjusted for the inflammation and endothelial dysfunction scores, despite the continuing smoking-related higher levels of inflammation and endothelial dysfunction. Smoking was not associated with aorto-radial and aorto-dorsalis pedis PWV.Conclusion Starting to smoke in adolescence and continuing to do so up to young adulthood is adversely associated with aortic stiffness. The continuing smoking-related aortic stiffness was not explained by concomitant higher inflammation and endothelial dysfunction. Prevention of smoking should target the young to prevent arterial stiffness in young adults.<br/
Anomalous Lattice Vibrations of Single and Few-Layer MoS2
Molybdenum disulfide (MoS2) of single and few-layer thickness was exfoliated
on SiO2/Si substrate and characterized by Raman spectroscopy. The number of
S-Mo-S layers of the samples was independently determined by contact-mode
atomic-force microscopy. Two Raman modes, E12g and A1g, exhibited sensitive
thickness dependence, with the frequency of the former decreasing and that of
the latter increasing with thickness. The results provide a convenient and
reliable means for determining layer thickness with atomic-level precision. The
opposite direction of the frequency shifts, which cannot be explained solely by
van der Waals interlayer coupling, is attributed to Coulombic interactions and
possible stacking-induced changes of the intralayer bonding. This work
exemplifies the evolution of structural parameters in layered materials in
changing from the 3-dimensional to the 2-dimensional regime.Comment: 14 pages, 4 figure
Erythematous nodes, urticarial rash and arthralgias in a large pedigree with NLRC4-related autoinflammatory disease, expansion of the phenotype
Autoinflammatory disorders (AID) are a heterogeneous group of diseases, characterized by an unprovoked innate immune response, resulting in recurrent or ongoing systemic inflammation and fever1-3. Inflammasomes are protein complexes with an essential role in pyroptosis and the caspase-1-mediated activation of the proinflammatory cytokines IL-1β, IL-17 and IL-18
Occupational exposure to gases/fumes and mineral dust affect DNA methylation levels of genes regulating expression
Many workers are daily exposed to occupational agents like gases/fumes, mineral dust or biological dust, which could induce adverse health effects. Epigenetic mechanisms, such as DNA methylation, have been suggested to play a role. We therefore aimed to identify differentially methylated regions (DMRs) upon occupational exposures in never-smokers and investigated if these DMRs associated with gene expression levels. To determine the effects of occupational exposures independent of smoking, 903 never-smokers of the LifeLines cohort study were included. We performed three genome-wide methylation analyses (Illumina 450 K), one per occupational exposure being gases/fumes, mineral dust and biological dust, using robust linear regression adjusted for appropriate confounders. DMRs were identified using comb-p in Python. Results were validated in the Rotterdam Study (233 never-smokers) and methylation-expression associations were assessed using Biobank-based Integrative Omics Study data (n = 2802). Of the total 21 significant DMRs, 14 DMRs were associated with gases/fumes and 7 with mineral dust. Three of these DMRs were associated with both exposures (RPLP1 and LINC02169 (2x)) and 11 DMRs were located within transcript start sites of gene expression regulating genes. We replicated two DMRs with gases/fumes (VTRNA2-1 and GNAS) and one with mineral dust (CCDC144NL). In addition, nine gases/fumes DMRs and six mineral dust DMRs significantly associated with gene expression levels. Our data suggest that occupational exposures may induce differential methylation of gene expression regulating genes and thereby may induce adverse health effects. Given the millions of workers that are exposed daily to occupational exposures, further studies on this epigenetic mechanism and health outcomes are warranted
Activating transcription factor 6 polymorphisms and haplotypes are associated with impaired glucose homeostasis and type 2 diabetes in dutch Caucasians
Context: Activating transcription factor 6 (ATF6) is critical for initiation and full activation of the unfolded protein response. An association between genetic variation in ATF6 and type 2 diabetes (DM2) was recently reported in Pima Indians. Objectives: To investigate the broader significance of this association for DM2, replication studies in distinct ethic populations are required. We investigated ATF6 for its association with DM2 in Dutch Caucasians. Design/Setting: A genetic association study was conducted at an academic research laboratory. Study Participants: Two independent Dutch cohorts were studied. Cohort 1 (n = 154) was used to evaluate genetic variation in the ATF6 gene in relation to glucose homeostasis in the general population. Cohort 2 (n = 798) consisted of patients with DM2, impaired glucose tolerance, impaired fasting glucose, and normoglycemic control subjects, and was used to investigate ATF6 polymorphisms for their contribution to disturbed glucose homeostasis and DM2. Main Outcome Measures: There were 16 tag single nucleotide polymorphisms genotyped in all subjects of both cohorts. Those single nucleotide polymorphisms included three nonsynonymous coding variants and captured all common allelic variation of ATF6. Results: Our data show that common ATF6 variants are associated with elevated glucose levels in the general population (cohort 1, P = 0.005-0.05). Furthermore, the majority of these variants, and haplotypes thereof, were significantly associated with impaired fasting glucose, impaired glucose tolerance, and DM2 ( cohort 2, P = 0.006-0.05). Associated variants differ from those identified in Pima Indians. Conclusions: Our results strengthen the evidence that one or more variants in ATF6 are associated with disturbed glucose homeostasis and DM2
Effect of atorvastatin on C-reactive protein and benefits for cardiovascular disease in patients with type 2 diabetes: analyses from the Collaborative Atorvastatin Diabetes Trial
CARDS was partially funded by Diabetes UK and the
National Health Service Research and Development Forum (England)
- …
