The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos

The renewable energy and energy efficiency potential of Waitakere City : a thesis presented in partial fulfilment of the requirements for the degree of Masters of Technology in Energy Management at Massey University

Electricity restrictions and blackouts have occurred in Waitakere City in the past and are likely to occur again in the future unless the city can become more self reliant by meeting, at least in part, the increasing energy requirements for what is one of the fastest growing cities in New Zealand. In this study the potentials for energy conservation, energy efficiency and renewable energy resources have been broadly quantified and assessed using desktop analysis of publicly available data for stationary final use energy systems (i.e. excluding transportation) within the geographical area of Waitakere City and adjoining waters. It was found that energy efficiency and energy conservation measures can consistently and predictably achieve overall energy savings and reduce daily and seasonal peak demand. The best renewable energy resource potential exists with solar and geothermal for heating applications and wave, offshore and inshore wind and tidal currents for electricity generation. There is very limited potential for hydro and bioenergy systems beyond what already exists. PV solar and land based wind power generation are currently only feasible for limited off-grid applications. This scoping study confirms the achievability of the vision expressed in Waitakere City Council's "Long Term Council Community Plan" (LTCCP) that by 2020 " Waitakere City will be an energy cell, not an energy sink. Air quality supports good health". A range of flagship projects have been identified to progress the achievement of this vision. Waitakere City Council can use this report as part of the development of a comprehensive energy management plan

Between session reliability of heel-to-toe progression measurements in the stance phase of gait

© 2018 Ade et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. The objective of the current study was to determine the test-retest reliability of heel-to-toe progression measures in the stance phase of gait using intraclass correlation coefficient (ICC) analysis. It has been proposed that heel-to-toe progression could be used as a functional measure of ankle muscle contracture/weakness in clinical populations. This was the first study to investigate the test-retest reliability of this measure. Eighteen healthy subjects walked over the GAITRite® mat three times at a comfortable speed on two sessions (≥ 48 hours apart). The reliability of the heel-to-toe progression measures; heel-contact time, mid-stance time and propulsive time were assessed. Also assessed were basic temporal-spatial parameters; velocity, cadence, stride length, step length, stride width, single and double leg support time. Reliability was determined using the ICC(3,1) model and, fixed and proportional biases, and measures of variability were assessed. Basic gait temporal-spatial parameters were not different between sessions (p > 0.05) and had excellent reliability (ICC(3,1) range: 0.871–0.953) indicating that subjects walked similarly between sessions. Measurement of heel-to-toe progression variables were not different between sessions (p > 0.05) and had excellent reliability (ICC(3,1) range: 0.845–0.926). However, these were less precise and more variable than the measurement of standard temporal-spatial gait variables. As the current study was performed on healthy populations, it represents the ‘best case’ scenario. The increased variability and reduced precision of heel-to-toe progression measurements should be considered if being used in clinical populations

The ATF6-Met [67] Val substitution is associated with increased plasma cholesterol levels

Objective— Activating transcription factor 6 (ATF6) is a sensor of the endoplasmic reticulum stress response and regulates expression of several key lipogenic genes. We used a 2-stage design to investigate whether ATF6 polymorphisms are associated with lipids in subjects at increased risk for cardiovascular disease (CVD). Methods and Results— In stage 1, 13 tag-SNPs were tested for association in Dutch samples ascertained for familial combined hyperlipidemia (FCHL) or increased risk for CVD (CVR). In stage 2, we further investigated the SNP with the strongest association from stage 1, a Methionine/Valine substitution at amino-acid 67, in Finnish FCHL families and in subjects with CVR from METSIM, a Finnish population-based cohort. The combined analysis of both stages reached region-wide significance (P=9x10–4), but this association was not seen in the entire METSIM cohort. Our functional analysis demonstrated that Valine at position 67 augments ATF6 protein and its targets Grp78 and Grp94 as well as increases luciferase expression through Grp78 promoter. Conclusions— A common nonsynonymous variant in ATF6 increases ATF6 protein levels and is associated with cholesterol levels in subjects at increased risk for CVD, but this association was not seen in a population-based cohort. Further replication is needed to confirm the role of this variant in lipids. We report the association of the ATF6-methionine [67]valine amino-acid substitution with plasma cholesterol levels. Association analyses in 2674 subjects and functional data suggest that the ATF6 gene may influence cholesterol levels in subjects at increased risk to develop cardiovascular disease

Endoplasmic reticulum stress-induced apoptosis in the development of diabetes: is there a role for adipose tissue and liver?

Diabetes mellitus (DM) is a multifactorial chronic metabolic disease characterized by hyperglycaemia. Several different mechanisms have been implicated in the development of the disease, including endoplasmic reticulum (ER) stress. ER stress is increasingly acknowledged as an important mechanism in the development of DM, not only for β-cell loss but also for insulin resistance. Accumulating evidence suggests that ER stress-induced apoptosis may be an important mode of β-cell loss and therefore important in the development of diabetes. Recent data also suggest a role of ER stress-induced apoptosis in liver and adipose tissue in relation to diabetes, but more extensive studies on human adipocyte and hepatocyte (patho)physiology and ER stress are needed to identify the exact interactions between environmental signals, ER stress and apoptosis in these organs

Methylglyoxal and glyoxalase I in atherosclerosis

Abstract Cardiovascular disease, caused predominantly by atherosclerotic plaque rupture, remains one of the leading causes of death. However, the mechanism of plaque rupture remains largely unknown. Recent studies have linked high metabolic activity in inflamed atherosclerotic plaques to the development of plaque rupture. AGEs (advanced glycation end-products) are known to be formed as a result of high metabolic activity and are higher in rupture-prone than stable plaques. Furthermore, AGEs seem to be more than mere markers of metabolic activity, as recent studies have elucidated that AGEs and their major precursor, MG (methylglyoxal), may have an important role in the progression of atherosclerosis and plaque rupture. MG can be detoxified by Glo1 (glyoxalase I), thereby preventing the accumulation of MG and MG-derived AGEs. In the present review, data concerning MG, Glo1 and AGEs in the context of plaque phenotype are discussed