“Non credo ai miei occhi”! Un approccio psico-sociale alle visual fake news

In its intrinsic ambivalence, the web presents two ‘sides’: the one that creates opportunities and the one that poses risks. Within the context of the processes of construction and transmission of news, there is a variety of phenomena related to the so-called "information disorders" (Wardle Derakhshan, 2017). Fake news (the most widespread forms of disinformation) represents an insidious form of "post-truth rhetoric" (McComiskey, 2017) and stimulates the brain to detect its risks, which range from the weakening of readers confidence in information sources to the difficulty in distinguishing the true from the false (Shu et al., 2020). Within this context, a key role is played by images. Starting from these premises, this paper  aims to deepen, in the context of social psychology and communication, thus going beyond the purely linguistic aspect, how the 'visual' part of news can contribute to the distortion of both the information provided and the main subject, in this case migrants. Therefore, this paper analyzes 99 false reports on immigration in order to understand the role played by images and to detect whether a stereotypical representation of immigration is present. Nella sua intrinseca ambivalenza, il web opera presentando molteplici facce, riconducibili ai due estremi del creare opportunità e generare rischi. Proprio nell’ambito dei processi di costruzione e trasmissione delle notizie, si riscontra una varietà di fenomeni afferenti ai cosiddetti “disturbi informativi” (Wardle Derakhshan, 2017). Considerate tra le forme di disinformazione più diffuse, le fake news rappresentano forme insidiose di “post-truth rhetoric” (McComiskey, 2017), stimolando la ricerca psicosociale a rilevare i rischi legati alla fruizione delle stesse, che vanno dalla erosione della fiducia dei lettori nei confronti del mondo delle informazioni agli ostacoli rispetto alla loro abilità di differenziare ciò che è vero da ciò che è falso (Shu et al., 2020). Tra le molteplici modalità attraverso cui una fake news viene “confezionata”, un ruolo particolare è svolto dalle immagini. Partendo da tali premesse, il presente contributo si propone di approfondire, nell’ambito della psicologia sociale e della comunicazione, oltre l’aspetto meramente linguistico, in che modo la parte il ‘visual’ delle notizie può  contribuire alla distorsione della notizia e del target descritto, rappresentato in questo caso dai migranti. A questo scopo sono state raccolte 99 notizie false riguardanti il tema dell’immigrazione e analizzate al fine di comprendere il ruolo svolto dalle immagini, ma soprattutto se questo è in qualche misura collegabile ad una visione stereotipica dell’immigrazione

PeppeRecycle: Improving Children’s Attitude Toward Recycling by Playing with a Social Robot

In this paper, we investigate the use of a social robot as an engaging interface of a serious game intended to make children more aware and well disposed towards waste recycle. The game has been designed as a competition between the robot Pepper and a child. During the game, the robot simultaneously challenges and teaches the child how to recycle waste materials. To endow the robot with the capability to play as a game opponent in a real-world context, it is equipped with an image recognition module based on a Convolutional Neural Network to detect and classify the waste material as a child would do, i.e. by simply looking at it. A formal experiment involving 51 primary school students is carried out to evaluate the effectiveness of the game in terms of different factors such as the interaction with the robot, the users’ cognitive and affective dimensions towards ecological sustainability, and the propensity to recycle. The obtained results are encouraging and draw promising scenarios for educational robotics in changing children’s attitudes toward recycling. Indeed Pepper turns out to be positively evaluated by children as a trustful and believable companion and this allows children to be concentrated on the “memorization” task during the game. Moreover, the use of real objects as waste items during the game turns out to be a successful approach not only for perceived learning effectiveness but also for the children’s engagement

President Obama’s Humble Face: An Authentic or a Socially Desirable Posturing? A Study on Reactions to Obama’s Autobiographical Self-Disclosures

Referring to the mainstream studies based on the personalization’s hypothesis, which positively evaluates signals of dominance shown by leaders, the analysis of Obama’s rhetoric stays a relevant exception. His risky recall, during his political talks, of his social difficulties as a child of a mixed couple was in fact one of the more surprising aspects of his success. Nevertheless, reactions to his autobiographical sharing were scarcely explored. Based on the idea that these self-disclosures signal his responsivity toward the audience of low social condition and can, therefore, be defined as a sign of humility, this research aims to test if coherence between Obama’s words and his facial expressions of contempt, due to the seriousness of social injustices endured in his childhood, may influence the receivers’ perception of such unexpected communication. Before reading a brief autobiographical sharing taken from a “Back-to-school” speech, a highly ritualized monolog the US President addresses each year to students, 175 Italian participants were presented with a photo of Obama displaying either an expression of contempt (taken from the video of the speech) or a neutral expression. Comparisons between self-assessments of perceptions and reactions of participants assigned to the two experimental conditions show that a facial expression of contempt, coherent with words describing his school difficulties, has been crucial for perceiving this humble political discourse as authentic and not as a simple socially desirable posturing. More studies seem to be needed, however, to understand how humble speech could enhance the positive face of leaders or backfire against them

Structural and Vibro-Acoustics Optimization of a Car Body Rear Part

The perceived vibro-acoustic comfort, inside the passenger compartment, under driving conditions, is strictly related to the car body torsional behavior. The aim of this work was to identify which parts of a car body most influence the first torsional mode, in order to modify them and acquire an increase in such car body natural frequency. It was also intended to exploit the great potential of 3D printing that allows an increase in the complexity of component shapes, with an acceptable compromise with respect to production costs. A design and material (from steel to aluminum) change of a car body rear part, which was identified as the structural part of the car body with the most relevant impact on the frequency of the first torsional mode, was assessed in terms of structural and vibro-acoustic performances. In particular, with the constraint of increasing the structural and vibroacoustic performances and, at the same time, minimize the weight of the structure itself, geometric, structural (e.g., type of connections), and material changes of the car body rear part were assessed. Working on a car model dating back to 2008, which was already compliant with structural and vibro-acoustic regulatory norms, an increase of 2 Hz on the first torsional mode frequency of the Trimmed Body model was obtained. In parallel, a weight reduction in the optimized components was also gained. It was also requested to lower the cabin sound pressure levels, optimizing the vibro-acoustic transfer functions from the accelerations at engine mounts and suspension attachment points to the cabin inside. It was shown how the combined use of advanced topological and structural optimization tools, with the capabilities of an unconventional manufacturing technology, such as 3D printing in aluminum, could guarantee an increase in the vibro-acoustics and structural car performances, also gaining a weight reduction

Design and Synthesis of a cADPR Mimic as a Novel Tool for Monitoring the Intracellular Ca2+ Concentration

Cyclic ADP-ribose (cADPR, 1, Figure 1) is a naturally occurring metabolite of NAD+ capable of mobilizing Ca2+ ions from intracellular stores. It was firstly isolated from sea urchin egg extract, but it was later established that it is also produced in many other mammalian cells, including pancreatic β-cells, T-lymphocytes, smooth and cardiac muscle cells, and cerebellar neurons, acting as a Ca2+-mobilizing agent. For this activity, cADPR has been classified as a second messenger that, by activating the ryanodine receptors of the sarcoplasmatic reticulum, is able to mobilize the calcium ions from intracellular stores. cADPR is involved in many physiological processes related to variation in the Ca2+ concentration, such as synaptic homeostasis in neurons as well as fertilization and cellular proliferation. This cyclic nucleotide, characterized by a very labile glycosidic bond at N1, is also rapidly hydrolysed in neutral aqueous solutions to inactive ADP-ribose. Matsuda and co-workers [1] were the first to synthesize new analogues of cADPR in which the adenine base is replaced by a hypoxanthine ring. This kind of modification produced the cyclic inosine diphosphate ribose (cIDPR), which proved to be stable in hydrolytic physiological conditions and showed significant Ca2+ mobilizing activity. Many modifications regarding the northern and southern ribose, as well as the purine base of cADPR, have been proposed so far. In our laboratories, we have synthesized several analogues of cIDPR [2–7]. In particular, the analogue with the northern ribose replaced by a pentyl chain (cpIDP) showed interesting Ca2+ mobilizing activity on the neuronal PC12 cell line [2]. Starting from these results, we report here the synthesis of the novel analogue 2, in which the “northern” ribose of cIDPR is replaced by a 2″,3″-dihydroxy pentyl chain. The effect of the presence of the diol moiety on the intracellular Ca2+ release will be assessed in due course

Development and performance testing of a miniaturized multi-sensor system combining MOX and PID for potential UAV application in TIC, VOC and CWA dispersion scenarios

The development of a tool to reduce the exposure of personnel in case of inten- tional or accidental toxic chemicals dispersion scenarios opens the field to new operational perspectives in the domain of operator safety and of critical infrastructure monitoring. The use of two sensors with different operating principles, metal oxide and photo-ionization detector, allows to confirm the presence of specific classes of chemicals in a contaminated area. All instruments are expected to be integrated into the payload of an unmanned aerial vehicle (UAV) and used for different purposes such as critical infrastructure surveillance focused on the volatile organic chemical and chemical warfare agents (CWA) detection and the post-incident of contamination level monitoring. In this paper, the authors presented the hardware set-up implemented and the test realized with CWAs simulants and will discuss the results obtained presenting advantages and disadvantages of this system in an application such as a UAV for the detection of chemical substances

Design of Miniaturized Sensors for a Mission-Oriented UAV Application: A New Pathway for Early Warning

In recent decades, the increasing threats associated with Chemical and Radiological (CR) agents prompted the development of new tools to detect and collect samples without putting in danger first responders inside contaminated areas. A particularly promising branch of these technological developments relates to the integration of different detectors and sampling systems with Unmanned Aerial Vehicles (UAV). The adoption of this equipment may bring significant benefits for both military and civilian implementations. For instance, instrumented UAVs could be used in support of specialist military teams such as Sampling and Identification of Biological, Chemical and Radiological Agents (SIBCRA) team, tasked to perform sampling in contaminated areas, detecting the presence of CR substances in field and then confirming, collecting and evaluating the effective threats. Furthermore, instrumented UAVs may find dual-use application in the civil world in support of emergency teams during industrial accidents and in the monitoring activities of critical infrastructures. Small size drones equipped with different instruments for detection and collection of samples may enable, indeed, several applications, becoming a tool versatile and easy to use in different fields, and even featuring equipment normally utilized in manual operation. The authors hereby present the design of miniaturized sensors for a mission-oriented UAV application and the preliminary results from an experimental campaign performed in 2020

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations

PRAME Expression in Mucosal Melanoma of the Head and Neck Region

PRAME (PReferentially expressed Antigen in MElanoma), a cancer-testis antigen expressed in normal and neoplastic tissues with several functions, proved to be a useful diagnostic tool in the differential diagnosis between benign and malignant melanocytic lesions. The current study aims to perform PRAME stain on a retrospective case series of mucosal melanocytic tumors of the head and neck region to compare 3 different scores and evaluate the most reliable one in this diagnostic set. Immunohistochemical analysis for PRAME was performed in 54 benign and malignant mucosal melanocytic tumors of the head and neck region collected from 41 patients. The best-performing cutoff of PRAME-positive cells (nuclear stain) to differentiate benign and malignant mucosal melanocytic tumors of the head and neck region is that proposed by Raghavan and colleagues (<60%/≥60% of PRAME-positive cells), with 100% and 77.8% of benign lesions and malignant tumors respectively correctly identified. Applying this score, PRAME stain showed the best results (sensitivity, specificity, accuracy, and positive and negative predictive values) for the diagnosis of head and neck melanocytic tumors. However, a subset of PRAME-negative malignant tumors was identified, especially located in the palatal area (hard and soft palate). Finally, high PRAME expression (≥60%) was associated with specific sites (nasal cavity/nasal septum/turbinates nasopharynx, and the maxillary sinus), nodular histotype, and female sex

The Heterogeneity of Skewness in T2W-Based Radiomics Predicts the Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer

Our study aimed to investigate whether radiomics on MRI sequences can differentiate responder (R) and non-responder (NR) patients based on the tumour regression grade (TRG) assigned after surgical resection in locally advanced rectal cancer (LARC) treated with neoadjuvant chemoradiotherapy (nCRT). Eighty-five patients undergoing primary staging with MRI were retrospectively evaluated, and 40 patients were finally selected. The ROIs were manually outlined in the tumour site on T2w sequences in the oblique-axial plane. Based on the TRG, patients were grouped as having either a complete or a partial response (TRG = (0,1), n = 15). NR patients had a minimal or poor nCRT response (TRG = (2,3), n = 25). Eighty-four local first-order radiomic features (RFs) were extracted from tumour ROIs. Only single RFs were investigated. Each feature was selected using univariate analysis guided by a one-tailed Wilcoxon rank-sum. ROC curve analysis was performed, using AUC computation and the Youden index (YI) for sensitivity and specificity. The RF measuring the heterogeneity of local skewness of T2w values from tumour ROIs differentiated Rs and NRs with a p-value ≈ 10−5; AUC = 0.90 (95%CI, 0.73–0.96); and YI = 0.68, corresponding to 80% sensitivity and 88% specificity. In conclusion, higher heterogeneity in skewness maps of the baseline tumour correlated with a greater benefit from nCR