Differences in Transcriptional Activity of Human Papillomavirus Type 6 Molecular Variants in Recurrent Respiratory Papillomatosis

<div><p>A significant proportion of recurrent respiratory papillomatosis (RRP) is caused by human papillomavirus type 6 (HPV-6). The long control region (LCR) contains cis-elements for regulation of transcription. Our aim was to characterize LCR HPV-6 variants in RRP cases, compare promoter activity of these isolates and search for cellular transcription factors (TFs) that could explain the differences observed. The complete LCR from 13 RRP was analyzed. Transcriptional activity of 5 variants was compared using luciferase assays. Differences in putative TFs binding sites among variants were revealed using the TRANSFAC database. Chromatin immunoprecipation (CHIP) and luciferase assays were used to evaluate TF binding and impact upon transcription, respectively. Juvenile-onset RRP cases harbored exclusively HPV-6vc related variants, whereas among adult-onset cases HPV-6a variants were more prevalent. The HPV-6vc reference was more transcriptionally active than the HPV-6a reference. Active FOXA1, ELF1 and GATA1 binding sites overlap variable nucleotide positions among isolates and influenced LCR activity. Furthermore, our results support a crucial role for ELF1 on transcriptional downregulation. We identified TFs implicated in the regulation of HPV-6 early gene expression. Many of these factors are mutated in cancer or are putative cancer biomarkers, and must be further studied.</p></div

Nucleotide sequence variability within the long control region (LCR) of human papillomavirus type 6 (HPV-6) molecular variants.

<p>Genomic positions containing specific mutations are indicated vertically across the top. Genomic positions without mutations compared to the HPV-6a-ref sequence (·), Insertions (I): I1 = TTATTGTATATCTTGTTACA; I2 = C nucleotide insertion.</p><p>Nucleotide sequence variability within the long control region (LCR) of human papillomavirus type 6 (HPV-6) molecular variants.</p

Clinical data of recurrent respiratory papillomatosis (RRP) patients harboring human papillomavirus type -6a and -6vc (HPV-6a and -6vc) related variants.

<p>Abbreviations: JORRP, juvenile onset recurrent respiratory papillomatosis; AORRP adult onset recurrent respiratory papillomatosis.</p><p>^a Fisher's exact test.</p><p>^b T-test.</p><p>Clinical data of recurrent respiratory papillomatosis (RRP) patients harboring human papillomavirus type -6a and -6vc (HPV-6a and -6vc) related variants.</p

Binding and activity of ELF1 and FOXA1 to HPV-6vc-ref and HPV-6vc-var1.

<p>Luciferase reporter assay for (A) ELF1 and (B) FOXA1. (C) Amplification of LCR fragments following chromatin immunoprecipitation (ChIP) using primers surrounding nucleotide position 7626 that differs among HPV-vc-ref and HPV-6vc-var1 variants. Input-nonimmunoprecipated samples.</p

Molecular variants of HPV-6 differ in early promoter activity.

<p>(A) Transcriptional activity of human papillomavirus type (HPV-6) molecular variants isolated from recurrent respiratory papillomatosis (RRP) cases. Data are presented as mean ± SD relative values from 3 independent experiments. Transcriptional activity was normalized to that of HPV-6a-ref which was arbitrarily defined as the reference and set to value 1. Kruskal-Wallis and Tukey’s tests were used to compare LCR activity among the different HPV-6 molecular variants. Asterisks indicate isolates that showed statistically significant different transcriptional activities compared to the corresponding references (HPV-6a-ref or HPV-6vc-ref). (P<0.001). (B) Putative cellular transcription factors binding sites within the long control region (LCR) that differ among the different molecular variants of human papillomavirus (HPV) type 6 detected.</p

Binding and activity of ELF1 and GATA1 to HPV-6a-ref and HPV-6a-var1.

<p>Luciferase reporter assay for (A) ELF1 and (B) GATA1. (C) Amplification of LCR fragments following chromatin immunoprecipitation (ChIP) using primers surrounding nucleotide position 16 that differs among HPV-6a-ref and HPV-6a-var1 variants. Input-nonimmunoprecipated samples.</p

Binding and activity of ELF1, GATA1 and FOXA1 to HPV-6a-ref and HPV-6vc-ref.

<p>(A) Luciferase reporter assay for GATA1. Amplification of LCR fragments following chromatin immunoprecipitation (ChIP) using primers surrounding nucleotide position (B) 7631/33 and (C) 7762 and that differ between HPV-6a-ref and HPV-6vc-var1 variants. Input-nonimmunoprecipated samples.</p