Diversity and Adaptation of Human Respiratory Syncytial Virus Genotypes Circulating in Two Distinct Communities: Public Hospital and Day Care Center

HRSV is one of the most important pathogens causing acute respiratory tract diseases as bronchiolitis and pneumonia among infants. HRSV was isolated from two distinct communities, a public day care center and a public hospital in Sao Jose do Rio Preto - SP, Brazil. We obtained partial sequences from G gene that were used on phylogenetic and selection pressure analysis. HRSV accounted for 29% of respiratory infections in hospitalized children and 7.7% in day care center children. On phylogenetic analysis of 60 HRSV strains, 48 (80%) clustered within or adjacent to the GA1 genotype; GA5, NA1, NA2, BA-IV and SAB1 were also observed. SJRP GA1 strains presented variations among deduced amino acids composition and lost the potential O-glycosilation site at amino acid position 295, nevertheless this resulted in an insertion of two potential O-glycosilation sites at positions 296 and 297. Furthermore, a potential O-glycosilation site insertion, at position 293, was only observed for hospital strains. Using SLAC and MEME methods, only amino acid 274 was identified to be under positive selection. This is the first report on HRSV circulation and genotypes classification derived from a day care center community in Brazil.FAPESP [2010/50444-4]FAPES

Prevalência de vírus respiratórios em crianças de creche com sintomas de infecções respiratórias agudas

As infecções do trato respiratório estão associadas com mortalidade significativa no mundo inteiro e afetam principalmente crianças menores de cinco anos de idade. A maioria das infecções respiratórias é causada por agentes virais como: Vírus Sincicial Respiratório (RSV), Influenzavírus tipo A e B (FLUA e FLUB), Parainfluenza tipo 1, 2 and 3 (PIV-1, PIV-2 e PIV-3), Rhinovirus (HRV) e Metapneumovirus Humano (hMPV). O conhecimento da epidemiologia e prevalência desses vírus é importante para que metodologias terapêuticas possam ser aplicadas apropriadamente e saber como esses vírus estão circulando. O objetivo deste trabalho foi investigar a incidência de 8 tipos de vírus respiratórios em 279 amostras de aspirado nasofaríngeo obtidas de Julho/2004 a Setembro de 2005 de 120 crianças (73 do sexo masculino e 47 do sexo feminino) com idade entre 0 a 6 anos com sintomas de infecção respiratória aguda. A análise foi realizada pela técnica de RT-PCR e seqüenciamento direto. Nossos resultados mostraram que 27,2% (76/279) das amostras foram positivas para pelo um dos vírus respiratórios, sendo 84,2% (64/76) de Picornavírus, 76,3% (58/76) de Rhinovírus e 7,9% de Enterovírus (6/76), 7,9% (6/76) de RSV, 1,3% (1/76) de hMPV, 2,6% (2/76) de FLUA, 2,6% (2/76) de PIV-1 e 1,3% (1/76) de PIV-2. As infecções repetidas acometeram 29% (22/76) das crianças com infecção respiratória. A maioria das re-infecções, 82% (18/22), foram pelo gênero Rhinovírus. Os sintomas mais freqüentes foram coriza diagnosticada em 89,5% dos casos (68/76) seguido de tosse em 67,1% (51/76). Os Rhinovírus foram detectados em todo o período de estudo, com picos de infecção nos meses de inverno e outono, porém não houve associação significativa entre a presença viral e a sazonalidade. Neste estudo houve prevalência de infecção e re-infecção por Rhinovírus. Portanto, este estudo...Respiratory tract infections are associated with significant mortality worldwide and affect mostly children under five years of age. Most respiratory infections are caused by viral agents such as: Respiratory Syncytial Virus (RSV), the viruses of Influenza type A and B (FLUA and FLUB), Parainfluenza type 1, 2 and 3 (PIV-1, PIV-2 and PIV-3), Rhinovirus (HRV) and Human Metapneumovirus (hMPV). Knowledge of the epidemiology and prevalence of these viruses is important for therapeutic methods can be applied as appropriate and to know how these viruses are circulating. The aim of this work was to investigate the incidence of 8 types of respiratory viruses in 279 samples of nasopharyngeal aspirated obtained from July/2004 to September/2005 of 120 children (73 male and 47 female) with age between 0 to 6 years with symptoms of acute respiratory infection. The analysis was performed by RT-PCR and direct sequencing. Our results showed that 27,2% (76/279) of samples were positive at least for a type of the respiratory viruses, with 84,2% (64/76) of Picornaviruses, with 76,3% (58/76) of Rhinovírus e 7,9% of Enterovírus (6/76), 7,9% (6/76) of RSV, 1,3% (1/76) of hMPV, 2,6% (2/76) of FLUA, 2,6% (2/76) of PIV-1 and 1,3% (1/76) of PIV-2. The recurrent infections affect 29% (22/76) of children with respiratory infection. Most re-infections, 82% (18/22), were by Rhinovírus genus. The most frequent symptoms were runny nose diagnosed in 89.5% (68/76) followed by cough in 67.1% (51/76). Rhinovírus were detected throughout the study period, with peaks of infection during the winter and autumn, but there was no significant association between viral presence and seasonality. In this study there was prevalence of infection and re-infection by Rhinovírus. Therefore, this study provided better understanding of the circulation of respiratory viruses in a population of day care in the region... (Complete abstract click electronic access below)Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP

Análise da variabilidade genética e expressão de HPV em papilomatose de laringe

Recurrent respiratory papillomatosis (RRP) is a disease characterized by the formation of benign papillomas in the upper respiratory tract. Human Papillomavirus infection (HPV) is the main cause of the disease, particularly types 6 and 11 which are considered low-risk oncogenic HPV. The promoter region LCR (Long Control Region) contains cis-regulatory elements for cellular and viral transcription factors (TF) that control viral early gene expression and replication. Nucleotide alterations within the LCR may overlap TFs elements and impact upon the binding affinity, the transcriptional activity and ultimately on the clinical outcome associated to HPV infections. Our aim was to characterize molecular variants of HPV among individuals diagnosed with RRP and to analyze the impact of LCR nucleotide divergence upon viral early transcription. LCR sequencing of the HPV-6 positive samples revealed five genomic variants not previously described. Through computational analysis, we found that nucleotide changes detected overlapps potential binding sites for several transcription factors. HPV-6vc-related variant was the most prevalent among the samples analyzed (69.2%) and more prevalent in cases of juvenile papillomatosis. Concerning transcriptional activity, HPV-6vc-related variant is more active than HPV-6a molecular variant. Further, we observed that other alterations observed strongly impacts transcriptional activity indirectly measured by luciferase assays. To our knowledge, this is the first report describing differences in promoter activity among naturally occurring variants of HPV-6. Research in this area is anticipated to provide important information concerning the biological significance of HPV-6 intratype genomic variabilityA papilomatose respiratória recorrente (PRR) é uma doença caracterizada pela formação de papilomas benignos no trato respiratório superior. A infecção pelo Papilomavírus Humano (HPV) é a principal causa da doença, principalmente os tipos 6 e 11, que são considerados de baixo risco oncogênico. A região promotora LCR (long control region) contêm elementos cis-reguladores para fatores transcricionais (FTs) celulares e virais que controlam a expressão gênica precoce e a replicação viral. Alterações nucleotídicas dentro da LCR podem sobrepor sítios de ligação de FTs e influenciar a afinidade de ligação, a atividade transcricional e o curso clínico das doenças associadas á infecções por HPV. Os objetivos deste trabalho foram caracterizar as variantes moleculares de HPV entre os indivíduos com diagnóstico de PRR e analisar o impacto da variabilidade nucleotídica da LCR sob a transcrição viral. O sequenciamento da LCR de amostras HPV-6 positivas revelou cinco variantes genômicas não descritas anteriormente. Por meio de análise computacional, observou-se que as alterações nucleotídicas detectadas sobrepõem potenciais sítios de ligação para alguns fatores de transcrição. A variante HPV-6vc foi a mais prevalente dentre as amostras analisadas (69,2%), sendo mais prevalente nos casos de papilomatose juvenil. Com relação à atividade transcricional, a variante HPV-6vc é mais ativa que a variante molecular HPV-6a. Além disso, observou-se que outras alterações observadas influenciaram na atividade transcricional que foi indiretamente medida por ensaios de luciferase. Vale ressaltar que este é o primeiro trabalho que descreve as diferenças de atividade do promotor entre variantes naturais de HPV-6. Esta pesquisa é de extrema relevância, pois fornece informações importantes sobre a função biológica de variabilidade genômica intratípica de HPV-6Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP

Differences in Transcriptional Activity of Human Papillomavirus Type 6 Molecular Variants in Recurrent Respiratory Papillomatosis

<div><p>A significant proportion of recurrent respiratory papillomatosis (RRP) is caused by human papillomavirus type 6 (HPV-6). The long control region (LCR) contains cis-elements for regulation of transcription. Our aim was to characterize LCR HPV-6 variants in RRP cases, compare promoter activity of these isolates and search for cellular transcription factors (TFs) that could explain the differences observed. The complete LCR from 13 RRP was analyzed. Transcriptional activity of 5 variants was compared using luciferase assays. Differences in putative TFs binding sites among variants were revealed using the TRANSFAC database. Chromatin immunoprecipation (CHIP) and luciferase assays were used to evaluate TF binding and impact upon transcription, respectively. Juvenile-onset RRP cases harbored exclusively HPV-6vc related variants, whereas among adult-onset cases HPV-6a variants were more prevalent. The HPV-6vc reference was more transcriptionally active than the HPV-6a reference. Active FOXA1, ELF1 and GATA1 binding sites overlap variable nucleotide positions among isolates and influenced LCR activity. Furthermore, our results support a crucial role for ELF1 on transcriptional downregulation. We identified TFs implicated in the regulation of HPV-6 early gene expression. Many of these factors are mutated in cancer or are putative cancer biomarkers, and must be further studied.</p></div

Nucleotide sequence variability within the long control region (LCR) of human papillomavirus type 6 (HPV-6) molecular variants.

<p>Genomic positions containing specific mutations are indicated vertically across the top. Genomic positions without mutations compared to the HPV-6a-ref sequence (·), Insertions (I): I1 = TTATTGTATATCTTGTTACA; I2 = C nucleotide insertion.</p><p>Nucleotide sequence variability within the long control region (LCR) of human papillomavirus type 6 (HPV-6) molecular variants.</p

Clinical data of recurrent respiratory papillomatosis (RRP) patients harboring human papillomavirus type -6a and -6vc (HPV-6a and -6vc) related variants.

<p>Abbreviations: JORRP, juvenile onset recurrent respiratory papillomatosis; AORRP adult onset recurrent respiratory papillomatosis.</p><p>^a Fisher's exact test.</p><p>^b T-test.</p><p>Clinical data of recurrent respiratory papillomatosis (RRP) patients harboring human papillomavirus type -6a and -6vc (HPV-6a and -6vc) related variants.</p

Binding and activity of ELF1 and FOXA1 to HPV-6vc-ref and HPV-6vc-var1.

<p>Luciferase reporter assay for (A) ELF1 and (B) FOXA1. (C) Amplification of LCR fragments following chromatin immunoprecipitation (ChIP) using primers surrounding nucleotide position 7626 that differs among HPV-vc-ref and HPV-6vc-var1 variants. Input-nonimmunoprecipated samples.</p

Binding and activity of ELF1 and GATA1 to HPV-6a-ref and HPV-6a-var1.

<p>Luciferase reporter assay for (A) ELF1 and (B) GATA1. (C) Amplification of LCR fragments following chromatin immunoprecipitation (ChIP) using primers surrounding nucleotide position 16 that differs among HPV-6a-ref and HPV-6a-var1 variants. Input-nonimmunoprecipated samples.</p