241 research outputs found
Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli
Screening Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprises detecting a combination (C1) of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB, where the result of the screening process is positive if the presence of two genes of the combination (C1) is detected in the biological sample. Independent claims are included for: (1) a nucleotide probe or primer used in a method of screening Xanthomonas axonopodis pathovar phaseoli, where the primer or the probe has a length of 12-30 nucleotides and comprising at least 12 consecutive nucleotides from a nucleic acid of the nucleic acid sequence of SEQ ID NOs: 5-12 (e.g. ccatgctgagcacggtcatt (SEQ ID NO: 5), cgccttccagttgctgacat (SEQ ID NO: 6), acgagcccttcccaaactagc (SEQ ID NO: 7), taccaacatcgtacgcttccc (SEQ ID NO: 8), cgtcagtgagtgctcggttg (SEQ ID NO: 9) and tcagagccctggaagcaaga (SEQ ID NO: 10)), and the nucleic acids of complementary sequence; and (2) a kit for detection of Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprising two pairs of primers for amplifying the combination of the two genes (C1) and the nucleotide probe or primer
Impact of a Community Pharmacist-Delivered Information Program on the Follow-up of Type-2 Diabetic Patients: A Cluster Randomized Controlled Study.
Low-quality communication between patients and care providers and limited patient knowledge of the disease and the therapy are important factors associated with poor glycemic control in patients with type 2 diabetes. We conducted a multicenter study to determine whether structured and tailored information delivered by pharmacists to type 2 diabetic patients could improve patient treatment adherence, hemoglobin A1c (HbA1c) levels and knowledge about diabetes.
One hundred seventy-four pharmacies were randomized to deliver an educational program on diet, drug treatment, disease and complications during three 30-min interviews over a 6-month period, or to provide no intervention, to type 2 diabetic patients treated with oral antidiabetic agents. Medication adherence was assessed by measuring the medication possession ratio and diabetes control by collecting HbA1c values. Levels of patient treatment self-management and disease knowledge were assessed using self-questionnaires.
Three hundred seventy-seven patients were analyzed. The medication possession ratio, already very high at baseline in the intervention (94.8%) and control (92.3%) groups, did not vary significantly after 6 months with no difference between the two groups. Significant decreases in HbA1c were observed in both groups at 6 months (p < 0.001) and 12 months (p < 0.01), with significantly greater changes from baseline in the intervention group than in the control group at 6 months (- 0.5% vs. - 0.2%, p = 0.0047) and 12 months (- 0.6% vs. - 0.2%, p = 0.0057). Patients in the intervention group showed greater improvement in their ability to self-manage treatment (+ 4.86 vs. + 1.58, p = 0.0014) and in the extent of their knowledge about diabetes (+ 0.6 vs. + 0.2, p < 0.01) at 6 months versus baseline compared with the control group.
Tailored information provided by the pharmacist to patients with type 2 diabetes did not significantly improve the already high adherence rates, but was associated with a significant decrease in HbA1c and an improvement of patient knowledge about diabetes.
ISRCTN33776525.
MSD France
Oxide phase characterization in simulated high burn-up UO2 fuels in the early stages of a nuclear severe accident
International audienc
Test diagnostique non invasif de morphométrie automatisée de l'histologie des polypes coliques
Test diagnostique non invasif de morphométrie automatisée de l’histologie des polypes colique
The effects of anatomical information and observer expertise on abnormality detection task
This paper presents a novel study investigating the influences of Magnetic Resonance (MR) image anatomical information and observer expertise on an abnormality detection task. MRI is exquisitely sensitive for detecting brain abnormalities, particularly in the evaluation of white matter diseases, e.g. multiple sclerosis (MS). For this reason, MS lesions are simulated as the target stimuli for detection in the present study. Two different image backgrounds are used in the following experiments: a) homogeneous region of white matter tissue, and b) one slice of a healthy brain MR image. One expert radiologist (more than 10 years\u27 experience), three radiologists (less than 5 years\u27 experience) and eight naïve observers (without any prior medical knowledge) have performed these experiments, during which they have been asked different questions dependent upon level of experience; the three radiologists and eight naïve observers were asked if they were aware of any hyper-signal, likely to represent an MS lesion, while the most experienced consultant was asked if a clinically significant sign was present. With the percentages of response "yes" displayed on the y-axis and the lesion intensity contrasts on the x-axis, psychometric function is generated from the observer\u27 responses. Results of psychometric functions and calculated thresholds indicate that radiologists have better hyper-signal detection ability than naïve observers, which is intuitively shown by the lower simple visibility thresholds of radiologists. However, when radiologists perform a task with clinical implications, e.g. to detect a clinically significant sign, their detection thresholds are elevated. Moreover, the study indicates that for the radiologists, the simple visibility thresholds remain the same with and without the anatomical information, which reduces the threshold for the clinically significant sign detection task. Findings provide further insight into human visual system processing for this specific task, and this study provides the foundation for a series of studies investigating numerical observer modeling to be designed, with the ultimate aim of investigating the medical image quality assessment approach by addressing the perspective of radiologist diagnostic performance
Pregabalin Poisoning: Evaluation of Dose-Toxicity Relationship
Context: Pregabalin poisoning is mostly benign, although coma and convulsions occasionally occur. Aim: To determine the dose-toxicity relationship of pregabalin. Methods: Dose-toxicity data of isolated pregabalin poisonings were collected from (1) a prospective study performed by the Dutch Poisons Information Centre (4 April 2014 to 4 October 2016) and from (2) case reports and case series reported in literature. Poisonings were graded using the Poisoning Severity Score (PSS) and the relationship between dose (mg kg −1) and PSS was evaluated. Results: In our study (n = 21 patients), the most commonly observed symptoms were drowsiness (62%), confusion (29%) and apathy (24%). PSS was none in three (14%), minor in 15 (71%), and moderate in three patients (14%). Most case series also reported a PSS of none to minor in the majority of poisonings (69-100%). For 34 individual patients (21 from our study and 13 from literature), detailed data on dose and clinical course were available to examine the dose-toxicity relationship. The median dose was significantly lower in the PSS none-minor group (“benign”) (8.6 mg kg −1, interquartile range (IQ25-75) 5.0-17.6 mg kg −1) than in the PSS moderate-severe group (“significant toxicity”) (46.7 mg kg −1, IQ25-75 21.3-64.3 mg kg −1); estimate of the median difference = 27.3 mg kg −1 (95% confidence interval (CI): 10-48.6). Conclusions: In general, higher pregabalin doses result in more severe poisonings. Below 20 mg kg −1 the majority of patients (83%) only suffer from mild poisoning. However, large interindividual differences exist in pregabalin-induced toxicity. Therefore, pre-hospital triage should not only include pregabalin dose, but also underlying illnesses, co-exposures and reported symptoms
Phenoplant: a web resource for the exploration of large chlorophyll fluorescence image datasets
Background
Image analysis is increasingly used in plant phenotyping. Among the various imaging techniques that can be used in plant phenotyping, chlorophyll fluorescence imaging allows imaging of the impact of biotic or abiotic stresses on leaves. Numerous chlorophyll fluorescence parameters may be measured or calculated, but only a few can produce a contrast in a given condition. Therefore, automated procedures that help screening chlorophyll fluorescence image datasets are needed, especially in the perspective of high-throughput plant phenotyping.
Results
We developed an automatic procedure aiming at facilitating the identification of chlorophyll fluorescence parameters impacted on leaves by a stress. First, for each chlorophyll fluorescence parameter, the procedure provides an overview of the data by automatically creating contact sheets of images and/or histograms. Such contact sheets enable a fast comparison of the impact on leaves of various treatments, or of the contrast dynamics during the experiments. Second, based on the global intensity of each chlorophyll fluorescence parameter, the procedure automatically produces radial plots and box plots allowing the user to identify chlorophyll fluorescence parameters that discriminate between treatments. Moreover, basic statistical analysis is automatically generated. Third, for each chlorophyll fluorescence parameter the procedure automatically performs a clustering analysis based on the histograms. This analysis clusters images of plants according to their health status. We applied this procedure to monitor the impact of the inoculation of the root parasitic plant Phelipanche ramosa on Arabidopsis thaliana ecotypes Col-0 and Ler.
Conclusions
Using this automatic procedure, we identified eight chlorophyll fluorescence parameters discriminating between the two ecotypes of A. thaliana, and five impacted by the infection of Arabidopsis thaliana by P. ramosa. More generally, this procedure may help to identify chlorophyll fluorescence parameters impacted by various types of stresses. We implemented this procedure at http://www.phenoplant.org webcite freely accessible to users of the plant phenotyping community
Alarming increase in poisonings from recreational nitrous oxide use after a change in EU-legislation, inquiries to the Dutch Poisons Information Center
BACKGROUND: After the change in EU-legislation in 2014, recreational use of nitrous oxide (N2O) increased in the Netherlands from 2015 onwards. We studied the effect on N2O poisonings during an 11 year period. METHODS: A retrospective observational study was performed on the incidence rate of N2O poisonings, relative to all recreational drug poisonings reported to the Dutch Poisons Information Center (DPIC) from 2010-2020. Secondary outcomes were the frequency of heavy use, frequent use, co-exposures, and toxicity in 2019 and 2020. RESULTS: 433 N2O poisonings were included. The incidence rate increased exponentially from 0.12% in 2010 to 11% in 2020, with an average monthly rate of 3.8%. In 2019 and 2020, 79% of the patients indicated heavy use, frequent use or both, and 42% used from large cylinders. Chronic toxicity (signs of peripheral neuropathy) was reported in 38% of the patients. CONCLUSION: The rate of N2O poisonings increased alarmingly in the Netherlands. An increasing proportion of patients reported problematic heavy or frequent use, accompanied by chronic toxicity
Abnormal T-cell phenotype in episodic angioedema with hypereosinophilia (Gleich's syndrome): frequency, clinical implication and prognosis
BACKGROUND: Episodic Angioedema with eosinophilia (EAE, Gleich\u27s syndrome) is a rare disorder consisting of recurrent episodes of angioedema, hypereosinophilia and frequent elevated serum Immunoglobin M.
METHODS: We conducted a retrospective multicenter nationwide study regarding the clinical spectrum and therapeutic management of patients with EAE in France.
RESULTS: Thirty patients were included with a median age at diagnosis of 41 years [5-84]. The median duration of each crisis was 5.5 days [1-90] with swelling affecting mainly the face and the upper limbs. Total serum IgM levels were increased in 20 patients (67%). Abnormal T-cell immunophenotypes were detected in 12 patients (40%) among which 5 (17%) showed evidence of clonal TCR γ gene rearrangement. Median follow-up duration was 53 months [31-99]. The presence of an abnormal T-cell population was the sole factor associated with a shorter time to flare (hazard ratio 4.15 [CI 95% 1.18-14.66; p=0.02). At last follow-up, 3 patients (10%) were able to withdraw all treatments and 11 (37%) were in clinical and biological remission with less than 10 mg of daily prednisone.
CONCLUSION: EAE is a heterogeneous condition that encompasses several disease forms. Although patients usually respond well to glucocorticoids, those with evidence of abnormal T-cell phenotype have a shorter time to flare
- …