InterPro Curation: Integrating Predictive Protein Signatures Into Biological Hierarchies

InterPro is an integrated database of predictive protein signatures used for the classification and automatic annotation of proteins and genomes. As InterPro curators, we are responsible for assimilating information from our member databases and communicating it to our end users in a way that adds value to each individual signature. We categorise signatures according to their type (for example, Family, Domain or Repeat) and annotate entries with links to other databases, abstracts and protein matches.

The InterPro database also identifies relationships between entries. For example, signatures at a general Family level are related to more specific subfamilies through a Parent/Child relationship. Families may also Contain individual Domains. In this manner, we aim to build up a hierarchy of InterPro entries that correctly represents relationships between biological families and domains. Users may then easily identify related proteins and signatures as the InterPro database attempts to map out biological hierarchies. Here we discuss InterPro relations, the criteria for their formation and how they may be useful to users. We will also discuss the challenges of representing biological hierarchies when automating relationship formation and the role manual curation plays in ensuring that we accurately represent biological networks. 
&#xa

Structural studies on DNA G-quadrupIexes

Guanine-rich lengths of DNA are capable of self-assembly into higher order structures known as G-quadruplexes. Guanine rich DNA sequences from a range of biologically relevant regions in the human genome, most notably telomeric DNA, have been observed to form such structures. To date a wide variety of quadruplex structures have been experimentally determined. This thesis is primarily concerned with the characterisation of a G-rich region of DNA from the c-kit oncogene promoter region. This work investigates the ability of this sequence, d(AGGGAGGGCGCTGGGAGGAGGG) (known as c-kit I), to form quadruplex structures using a range of biophysical techniques, principally nuclear magnetic resonance, UV melting studies and CD spectroscopy. The structural and thermodynamic properties of a quadruplex forming from this sequence are comprehensively examined. G-quadruplexes are known to be sensitive to small mutations in their loop regions and a series of three mutated sequences was created with the aim of elucidating the effects of mutations on the quadruplex forming ability of this region of G-rich DNA. The effect of each mutation was examined using the biophysical methods outlined above. Molecular dynamics simulations have also been performed to investigate three different quadruplex topologies that this sequence may adopt in the solution phase. Free-energy calculations were undertaken to investigate the relative stabilities of the possible folds. The molecular dynamics simulations also provide an insight into the behaviour of the loop regions for a range of possible loop topologies. Ligand interaction with a model of the parallel c-kit I quadruplex was also studied by molecular dynamics in order to provide a structural rationale for ligand binding. A range of acridine-based ligands were studied and the model was validated by comparison with experimentally observed binding affinities. Modelling studies were also undertaken to examine the relative behaviour of two human telomeric quadruplex structures. Results show that the c-kit 1 sequence is capable of forming a single quadruplex species with a novel parallel motif. The sequence is highly sensitive to mutation; modified sequences do not show any quadruplex forming ability. Modelling studies on the human telomeric quadruplex folds reveal that base pairing contributes significantly to the overall stability of the 3+1 fold. The availability of these bases to participate in pairing interactions in vivo may determine the viability of the mixed fold in a cellular environment

Using a Survey Tool to Establish Preservation Priorities: Results from the Historical Folio Collection Survey at the Cushing/Whitney Medical Library, Yale University

Objective: An item-level survey was undertaken to reveal the preservation needs of a unique collection of rare medical historical folios and oversize anatomical atlases at the Harvey Cushing/John Hay Whitney Medical Library, Yale University. Methodology: During a re-shelving project, surveyors noted detailed preservation information in a FileMakerPro database. Recorded information included: dimensions, whether a new enclosure was needed, external status (condition of boards, spine, cover), internal status (cover-to-text attachment, paper), attributes (covering material, binding type, inclusions, bookplate owner, decoration), value/damage (value, damage summary, treatment summary), and photos. Results and Conclusions: Survey data revealed vital information for determining preservation priorities. The surveyors found that 13% of the collection was significantly damaged and 30% was in poor condition. A query of the survey tool identified the approximate value of the damaged folios and priority was subsequently given to items designated as treasures to the institution. The survey also revealed which items required immediate treatment for concerns such as active mold that threatened the security of neighboring materials. The surveyors recorded attributes of interest to historians and researchers (provenance, unusual bindings, the presence of hand-painted illustrations, etc..) which were used to identify items for exhibits. Special handling instructions were also assigned to fragile items to prevent future damage. Finally, the folio survey resulted in a proof-of-concept for other item-level surveys of valuable collections. Once conducted, the survey prevented further handling of rare materials and resulted in concrete information needed to make preservation decisions

The importance of concepts

Words change meaning over time. Some meaning shift is accompanied by a corresponding change in subject matter; some meaning shift is not. In this paper I argue that an account of linguistic meaning can accommodate the first kind of case, but that a theory of concepts is required to accommodate the second. Where there is stability of subject matter through linguistic change, it is concepts that provide the stability. The stability provided by concepts allows for genuine disagreement and ameliorative change in the context of conceptual engineering

Elf5-centered transcription factor hub controls trophoblast stem cell self-renewal and differentiation through stoichiometry sensitive shifts in target gene networks

Latos, P. A., Sienerth, A. R., Murray, A., Senner, C. E., Muto, M., Ikawa, M., . . . Hemberger, M. (2015). Elf5-centered transcription factor hub controls trophoblast stem cell self-renewal and differentiation through stoichiometry sensitive shifts in target gene networks. Genes and Development, 29(23), 2435-2448. doi:10.1101/gad.268821.11

A Critical Role of TET1/2 Proteins in Cell-Cycle Progression of Trophoblast Stem Cells.

The ten-eleven translocation (TET) proteins are well known for their role in maintaining naive pluripotency of embryonic stem cells. Here, we demonstrate that, jointly, TET1 and TET2 also safeguard the self-renewal potential of trophoblast stem cells (TSCs) and have partially redundant roles in maintaining the epithelial integrity of TSCs. For the more abundantly expressed TET1, we show that this is achieved by binding to critical epithelial genes, notably E-cadherin, which becomes hyper-methylated and downregulated in the absence of TET1. The epithelial-to-mesenchymal transition phenotype of mutant TSCs is accompanied by centrosome duplication and separation defects. Moreover, we identify a role of TET1 in maintaining cyclin B1 stability, thereby acting as facilitator of mitotic cell-cycle progression. As a result, Tet1/2 mutant TSCs are prone to undergo endoreduplicative cell cycles leading to the formation of polyploid trophoblast giant cells. Taken together, our data reveal essential functions of TET proteins in the trophoblast lineage

How achievable are COVID-19 clinical trial recruitment targets? A UK observational cohort study and trials registry analysis

Objectives: To analyse enrolment to interventional trials during the first wave of the COVID-19 pandemic in England and describe the barriers to successful recruitment in the circumstance of a further wave or future pandemics. Design: We analysed registered interventional COVID-19 trial data and concurrently did a prospective observational study of hospitalised patients with COVID-19 who were being assessed for eligibility to one of the RECOVERY, C19-ACS or SIMPLE trials. Setting: Interventional COVID-19 trial data were analysed from the clinicaltrials.gov and International Standard Randomized Controlled Trial Number databases on 12 July 2020. The patient cohort was taken from five centres in a respiratory National Institute for Health Research network. Population and modelling data were taken from published reports from the UK government and Medical Research Council Biostatistics Unit. Participants: 2082 consecutive admitted patients with laboratory-confirmed SARS-CoV-2 infection from 27 March 2020 were included. Main outcome measures: Proportions enrolled, and reasons for exclusion from the aforementioned trials. Comparisons of trial recruitment targets with estimated feasible recruitment numbers. Results: Analysis of trial registration data for COVID-19 treatment studies enrolling in England showed that by 12 July 2020, 29 142 participants were needed. In the observational study, 430 (20.7%) proceeded to randomisation. 82 (3.9%) declined participation, 699 (33.6%) were excluded on clinical grounds, 363 (17.4%) were medically fit for discharge and 153 (7.3%) were receiving palliative care. With 111 037 people hospitalised with COVID-19 in England by 12 July 2020, we determine that 22 985 people were potentially suitable for trial enrolment. We estimate a UK hospitalisation rate of 2.38%, and that another 1.25 million infections would be required to meet recruitment targets of ongoing trials. Conclusions: Feasible recruitment rates, study design and proliferation of trials can limit the number, and size, that will successfully complete recruitment. We consider that fewer, more appropriately designed trials, prioritising cooperation between centres would maximise productivity in a further wave