The nucleotide sequence of bacteriophage T 5 leucine tRNA

AbstractUniformly 32P-labeled bacteriophage T5 leucine tRNA has been isolated by two-dimensional gel electrophoresis from phage-infected E. coli cells. Its nucleotide sequence has been determined by conventional techniques using TLC on cellulose for oligonucleotide fractionation:pGGGGCUAUGCUGGAACDGmGDAGACAAUACGGCCUUAGm;6UΨCCGUAGCUUAAA UGCGUGGGAGT'ΨCGAGUCUCCCUAGCCCCACCAoh.This tRNA has anticodon sequence UAG, which can presumably recognize all the four leucine-specific codons (CUN). The main feature of T5 tRNALeu is the absence of the A10-C25 and C31-Ψ39 pairing in the D and anticodon stems, respectively

Cloning and DNA sequence of the 5'-exonuclease gene of bacteriophage T5

AbstractThe nucleotide sequence of the BalI-PstI fragment of T5 DNA, 1347 bp in length, coding for 5'-exonuclease (D15 gene), has been determined. A coding region of the gene contains 873 bp and is preceded by a typical Shine-Dalgarno sequence. The D15 gene belongs to a cluster, consisting of at least 3 genes, in which a termination codon of a preceding gene overlaps an initiation codon of the following one. The sequence contains an open reading frame for 291 amino acid residues. The molecular mass of the 5'-exonuclease calculated from the predicted amino acid sequence is 33400 Da