Top-Down proteomics based on LC-MS combined with cDNA sequencing to characterize multiple proteoforms of Amiata donkey milk proteins

An in-depth molecular characterization of the main milk proteins, caseins (CNs) and whey proteins, from Amiata donkey combining top-down proteomic analysis (LC-MS) and cDNA sequencing, revealed multiple proteoforms arising from complex splicing patterns, including cryptic splice site usage and exon skipping events. Posttranslational modifications, in particular phosphorylation, increased the variety and complexity of proteoforms. αs2-CN perfectly exemplifies such a complexity. With 2 functional genes, CSN1S2 I and CSN1S2 II, made of 20 and 16 exons respectively, nearly 30 different molecules of this CN were detected in the milk of one Amiata donkey. A cryptic splice site usage, leading to a singular shift of the open reading frame and generating two αs2-CN I isoforms with different C-terminal sequences, was brought to light. Twenty different αs1-CN molecules with different phosphorylation levels ranging between 4 and 9P were identified in a single milk sample, most of them resulting from exon skipping events and cryptic splice site usage. Novel genetic polymorphisms were detected for CNs (β- and αs-CN) as well as for whey proteins (lysozyme C and β-LG I). The probable new β-LG I variant, with a significantly higher mass than known variants, appears to display an N-terminal extension possibly related to the signal peptide sequence. This represents the most comprehensive report to date detailing the complexity of donkey milk protein micro-heterogeneity, a prerequisite for discovering new elements to objectify the original properties of donkey’s milk

Genome\u2011wide diversity and runs of homozygosity in the \u201cBraque Fran\ue7ais, type Pyr\ue9n\ue9es\u201d dog breed

Objective: Braque Fran\uc3\ua7ais, type Pyr\uc3\ua9n\uc3\ua9es is a French hunting-dog breed whose origin is traced back to old pointing gun-dogs used to assist hunters in finding and retrieving game. This breed is popular in France, but seldom seen elsewhere. Despite the ancient background, the literature on its genetic characterization is surprisingly scarce. A recent study looked into the demography and inbreeding using pedigree records, but there is yet no report on the use of molecular markers in this breed. The aim of this work was to genotype a population of Braque Fran\uc3\ua7ais, type Pyr\uc3\ua9n\uc3\ua9es dogs with the high-density SNP array to study the genomic diversity of the breed. Results: The average observed (HO) and expected (HE) heterozygosity were 0.371 (\uc2\ub1 0.142) and 0.359 (\uc2\ub1 0.124). Effective population size (NE) was 27.5635 runs of homozygosity (ROH) were identified with average length of 2.16 MB. A ROH shared by 75% of the dogs was detected at the beginning of chromosome 22. Inbreeding coefficients from marker genotypes were in the range FIS= [- 0.127, 0.172]. Inbreeding estimated from ROH (FROH) had mean 0.112 (\uc2\ub1 0.023), with range [0.0526, 0.225]. These results show that the Braque Fran\uc3\ua7ais, type Pyr\uc3\ua9n\uc3\ua9es breed is a relatively inbred population, but with still sufficient genetic variability for conservation and genetic improvement

EXPRESSION AND VARIABILITY STUDY OF GENES INFLUENCING QUALI-QUANTITATIVE DONKEY MILK TRAITS

Al fine di sviluppare ulteriori informazioni sul genoma di asina da utilizzare in piani selettivi per il miglioramento quali-quantitativo della produzione lattea, il progetto di dottorato si è incentrato sull’ individuazione e caratterizzazione di marcatori in geni candidati per studi di associazione con caratteri produttivi, analogamente a quanto già realizzato per la specie bovina, ovi-caprina e bufalina, e sulla caratterizzazione proteomica del latte d’asina

Analisi della struttura e della variabilita genetica al locus codificante la Prolattina (PRL) nella Bufala Mediterranea Italiana

L'obiettivo della presente tesi è l'analisi della struttura del gene codificante per la prolattina della Bufala Mediterranea Italiana allo scopo di individuare marcatori genetici utili per il miglioramento delle prestazioni produttive della specie. E' stato sequenziato l'intero gene della prolattina per un totale di 9860 basi: composto da 858 basi di regioni esoniche, 7741 di regioni introniche e 361 basi di regione promotrice. Su un campione di 755 esemplari di Bufala Mediterranea, allevate in quattro aziende, tre Campane(province di Caserta e Salerno) e una della Basilicata, è stata condotta una genotipizzazione per l'unica mutazione osservata(transizione C->T, al nucleotide 108 del 5° esone)è il primo allele individuato al locus PRL nella specie bufalina. Questi marcatori rivestono un ruolo importante, in quanto utili strumenti per studi di associazione con caratteri riproduttivi/produttivi di interesse economico. Inoltre possono essere utilizzati per la creazione di protocolli di rintracciabilità raziale del latte e dei suoi derivati e per studi filogenetici tra popolazioni bufaline di origine geografica diversa. The objective of this thesis is the analysis of the structure of the gene encoding for prolactin of the Mediterranean Italian Buffalo in order to identify genetic markers useful for the improvement of production performance of the species. Was sequenced the entire gene of prolactin for a total of 9860 bases: consisting of 858 bases of exonic regions, intronic regions of 7741 and 361 bases of the promoter region. . In a sample of 755 specimens of Mediterranean buffalo, bred in four companies, three Campane(the provinces of Caserta and Salerno) and one of the Basilicata, was conducted genotyping for the only mutation observed (transition C-> T, at nucleotide 108 of exon 5 °)is the first identified allele at locus PRL in buffalo species. These markers play an important role, as useful tools for association studies with reproductive / productive characters of economic interest. They can also be used for creating protocols of racial traceability of milk and its derivatives and for phylogenetic studies among buffalo populations of different geographical origin

Sequence analysis and genetic variability of Mediterranean river buffalo prolactin gene (PRL)

Prolactin (PRL) is one of the most versatile hormones of the pituitary gland in terms of biological actions. In particular, PRL is essential for mammary gland development, lactogenesis and milk protein gene expression. It has also considered as a potential quantitative trait locus affecting milk performance traits in dairy cattle. Aims of this study were to detect PRL gene polymorphisms and to investigate their effect in Mediterranean river buffalo milk yield. For this purpose, DNA was isolated from the blood collected from 757 unrelated lactating Mediterranean river buffaloes belonging to 14 farms located in Salerno, Caserta and Potenza provinces (Italy). Using primers designed on bubaline genome sequence we amplified and sequenced the entire PRL gene of 5 buffaloes randomly chosen. Seven-thousand one-hundred and fifty-one records for milk yield, measured monthly by the official recording system of the Italian Association of Buffalo Breeders on 1081 lactations of 544 buffaloes, were used. Association between PRL polymorphism and milk yield was investigated with a mixed linear model. The entire panel of Mediterranean river buffalo DNA samples were genotyped in outsourcing ANIMAL BREEDING AND GENOMICS (KBiosciences, Herts, UK) for the exonic SNP. The buffalo PRL gene extends over 8.6 kb including 0.858 kb of exonic regions and 7.741 kb of intronic regions plus 361 bp of the 5′UTR. The main feature of the buffalo PRL gene is simple architecture. It contains 5 exons ranging in size from 82 (exon 1) to 306 bp (exon 5) and 4 introns from 629bp (intron 4) to 2715bp (intron 1). The sequence comparison of buffalo PRL gene showed 34 intronic polymorphisms (11 transversions, 22 transitions and 1 single deletions/insertions) and a transition C→T at the 108th nucle- otide of the exon 5. The frequency of the PRL T108C SNP in the investigated population was 0.88 (genotype distribution: 589 T/T, 156 T/C, 12 C/C). The least-squares means for milk yield indicated a difference of 0.18 kg/day between the genotypes TT (n. subjects 432) and TC (105) or CC (7), whereas both TC and CC showed an average milk production of 8.32 kg/day. However, these differ- ences were not significant. Therefore, this SNP appears to be selectively neutral in relation to milk yield

Gene structure analysis of donkey oxytocin-neurophysin I (OXT) gene and genetic variability detection

Oxytocin is a neurohypophysial peptide released into general circulation from posterior pituitary gland. It is involved in different physiological roles, including milk ejection from the mammary gland, stimulation of uterine smooth muscle contraction during labour and affects cognitive processes, tolerance, adaptation and complex sexual and maternal behaviour. The main objective of the present research was to determine the complete donkey oxytocin-neurophysin I encoding gene (OXT) sequences and to detect genetic diversity at this locus. Using the genomic DNA as template, we sequenced and compared the whole OXT gene of 5 Italian donkeys: 2 Amiatine, 2 Ragusana and 1 Grigio Siciliano donkeys. On average the gene extends over 946 bp, composed of 517 bp of exonic regions and 429 bp of intronic regions, with an A/T and G/C content of about 27% and 73%, respectively. Furthermore, the 5’ flanking region (876 bp) was sequenced. The gene contains only three exons, ranging in size from 202 bp (exons 2) to 155 bp (exon 3), and two introns of 315 bp (intron 1) and 114 bp (intron 2). The first exon encodes a peptide leader (19 amino acids residues encoded by the nucleotides from 41 and 97), the nonapeptide hormone (from nucleotide 98 to 124), the tripeptide processing signal (GKR) (from nucleotides 125 and 133) and the first 9 of 94 residues of neurophysin I; the second exon encodes the central part of neurophysin I (67 aa), while the third exon encodes the COOH–terminal region of neurophysin I (18 aa). Among the different species of animals of species of livestock animals, the OXT donkey gene sequence showed the highest degree of similarity with the horse (98%) vs. ruminants (75%) and camelids (76%). The comparison of the sequences obtained allowed the identification of 5 SNPs: g.263A>G, g.334A>G, g.436T>C and g.304A>C in intron 1 and g.124G>A in promoter region. This last polymorphic site falls into a potential binding site for the transcription factor GATA-1 (www.generegulation. com). With this study, we provide the first contribution to the characterisation of the genomic sequence of the OXT gene and first examples of markers found at this locus in donkey. The detected polymorphisms represent a good opportunity to carry out studies focussed on the identification of significant association with the physiological processes controlled by this hormone as already performed in other species

Sequence variation and detection of a functional promoter polymorphism in the lysozyme c-type gene from Ragusano and Grigio Siciliano donkeys

Lysozyme is an antimicrobial agent in milk and inhibits growth of pathogenic bacteria.1,2 The vertebrate lysozyme gene family includes at leat three groups of genes: lactalbumin alpha (LALBA), lysozyme-like (LYZL*) and lysozyme (LYZ).3 The latter is the most studied in human, camel, ruminants and equine milk.4 Donkey milk contains 1.0 mg/ml OF lysozyme c, a higher concentration than in milk from ruminants (traces) and humans (0.12 mg/ml).5 Although genetic variants have been already reported in donkey LYZL*, 6 so far no information is available on the molecular variation for the LYZ locus in this species. In the present study, we report molecular variation of the donkey LYZ gene and the detection of functional polymorphisms. Blood samples were collected from 27 donkeys of two breeds (15 Ragusano and 12 Grigio Siciliano), and DNA was extracted. Using primers designed on donkey genome sequence (GeneBank NW_014638180.1, complement 1781536...1786728)

Genetic variability detected at the (c-type) milk lysozyme encoding gene in donkey

Lysozyme is known to be a natural antimicrobial agent since it catalyses the hydrolysis of glycosidic bonds of mucopolysaccharides in bacterial cell walls. It inhibites the development of many pathogens bacteria, thus making the milk somewhat selective in regards to the milk bacteria content. Three major distinct types of lysozymes have been identified: chicken-type (c-type), invertebrate-type (i-type), and goose-type (g-type). In particular, there are at least 4 non-stomach lysozyme genes in ruminants (i.e., mammary gland, kidney, trachea, intestinal). Lysozymes in ruminants and equine milk are considered to be the c-type because of their similarity to chicken egg white lysozyme. The c-type lysozyme content in donkey’s milk varies during the different stages of lactation with a mean value of 1.0mg/mL and proved to be higher than that in bovine, ovine, caprine (traces), whereas it was very close to mare’s milk. In the equine species, the c-type lysozyme encoding gene (4 exons) maps on chromosome 6 and transcribes a mRNA of 1329bp, coding for a protein of 148aa. To our knowledge, no information on genetic variability has been reported so far at this locus in donkey. Consequently, in order to detected variability, total RNA was extracted from milk somatic cells of 6 unrelated Ragusana donkeys reared in Central Italy. The mRNA fragment comprised between the last 84nt of exon 1 and the first 285nt of exon 4 was amplified by RT-PCR and sequenced. Primers (For GCAAGGTCTTTGAAAGATGT and Rev ACCAGCATTAGTTCTATTCG) were designed using as template the genomic donkey sequence (EMBL ID: NW_014638180). The obtained sequence (465bp) is relative to the cDNA tract spanning the last 64nt of exon 1 to the 236thnt of exon 4. Stop codon is located at the 65th67thnt of exon 4. Sequences comparison showed a transition G!A at the 160thnt of exon 2 (NW_014638180:g1784688C>T) responsible for the aa change Arg90!Gln. The presence of the codon CGA at exon 2 of the donkey milk lysozyme encoding gene might represent the ancestral condition of the gene in equidae, as it has also been found in other donkey and male sequences. The identification of this SNP could represent the first report of polymorphism at this locus in donkey. Next step of the research will be the analysis of a large number of samples in order to establish the frequency of this mutation in donkey species and to evaluate if and how the new genetic variant may influence functional and biological properties of donkey's milk