Rmi1 stimulates decatenation of double Holliday junctions during dissolution by Sgs1-Top3

double Holliday junction (dHJ) is a central intermediate of homologous recombination that can be processed to yield crossover or non-crossover recombination products. To preserve genomic integrity, cells possess mechanisms to avoid crossing over. We show that Saccharomyces cerevisiae Sgs1 and Top3 proteins are sufficient to migrate and disentangle a dHJ to produce exclusively non-crossover recombination products, in a reaction termed "dissolution." We show that Rmi1 stimulates dHJ dissolution at low Sgs1-Top3 protein concentrations, although it has no effect on the initial rate of Holliday junction (HJ) migration. Rmi1 serves to stimulate DNA decatenation, removing the last linkages between the repaired and template DNA molecules. Dissolution of a dHJ is a highly efficient and concerted alternative to nucleolytic resolution that prevents crossing over of chromosomes during recombinational DNA repair in mitotic cells and thereby contributes to genomic integrity

BLM and RMI1 alleviate RPA inhibition of topoIIIα decatenase activity

RPA is a single-stranded DNA binding protein that physically associates with the BLM complex. RPA stimulates BLM helicase activity as well as the double Holliday junction dissolution activity of the BLM-topoisomerase IIIα complex. We investigated the effect of RPA on the ssDNA decatenase activity of topoisomerase IIIα. We found that RPA and other ssDNA binding proteins inhibit decatenation by topoisomerase IIIα. Complex formation between BLM, TopoIIIα, and RMI1 ablates inhibition of decatenation by ssDNA binding proteins. Together, these data indicate that inhibition by RPA does not involve species-specific interactions between RPA and BLM-TopoIIIα-RMI1, which contrasts with RPA modulation of double Holliday junction dissolution. We propose that topoisomerase IIIα and RPA compete to bind to single-stranded regions of catenanes. Interactions with BLM and RMI1 enhance toposiomerase IIIα activity, promoting decatenation in the presence of RPA

Targeting Ultrasmall Gold Nanoparticles with cRGD Peptide Increases the Uptake and Efficacy of Cytotoxic Payload

Cyclic arginyl-glycyl-aspartic acid peptide (cRGD) peptides show a high affinity towards αVβ3 integrin, a receptor overexpressed in many cancers. We aimed to combine the versatility of ultrasmall gold nanoparticles (usGNP) with the target selectivity of cRGD peptide for the directed delivery of a cytotoxic payload in a novel design. usGNPs were synthesized with a modified Brust-Schiffrin method and functionalized via amide coupling and ligand exchange and their uptake, intracellular trafficking, and toxicity were characterized. Our cRGD functionalized usGNPs demonstrated increased cellular uptake by αVβ3 integrin expressing cells, are internalized via clathrin-dependent endocytosis, accumulated in the lysosomes, and when loaded with mertansine led to increased cytotoxicity. Targeting via cRGD functionalization provides a mechanism to improve the efficacy, tolerability, and retention of therapeutic GNPs

Analysis of the DNA unwinding activity of RecQ family helicases.

The RecQ family of DNA helicases is highly conserved in evolution from bacteria to mammals. There are five human RecQ family members (RECQ1, BLM, WRN, RECQ4 and RECQ5), defects, three of which give rise to inherited human disorders. Mutations of BLM have been identified in patients with Bloom's syndrome, WRN has been shown to be mutated in Werner's syndrome, while mutations of RECQ4 have been associated with at least a subset of cases of both Rothmund-Thomson syndrome and RAPADILINO. The most characteristic features of these diseases are a predisposition to the development of malignancies of different types (particularly in Bloom's syndrome), some aspects of premature aging (particularly in Werner's syndrome), and on the cellular level, genome instability. In order to gain understanding of the molecular defects underlying these diseases, many laboratories have focused their research on a study of the biochemical properties of human RecQ helicases, particularly those associated with disease, and of RecQ proteins from other organisms (e.g., Sgs1p of budding yeast, Rqh1p of fission yeast, and RecQ of E.coli). In this chapter, we summarize the assay systems that we employ to analyze the catalytic properties of the BLM helicase. We have successfully used these methods for the study of other RecQ and non-RecQ helicases, indicating that they are likely to be applicable to all helicases

RecQ helicases: guardian angels of the DNA replication fork

Since the original observations made in James German's Laboratory that Bloom's syndrome cells lacking BLM exhibit a decreased rate of both DNA chain elongation and maturation of replication intermediates, a large body of evidence has supported the idea that BLM, and other members of the RecQ helicase family to which BLM belongs, play important roles in DNA replication. More recent evidence indicates roles for RecQ helicases in what can broadly be defined as replication fork 'repair' processes when, for example, forks encounter lesions or adducts in the template, or when forks stall due to lack of nucleotide precursors. More specifically, several roles in repair of damaged forks via homologous recombination pathways have been proposed. RecQ helicases are generally only recruited to sites of DNA replication following fork stalling or disruption, and they do so in a checkpoint-dependent manner. There, in addition to repair functions, they aid the stabilisation of stalled replication complexes and seem to contribute to the generation and/or transduction of signals that enforce S-phase checkpoints. RecQ helicases also interact physically and functionally with several key players in DNA replication, including RPA, PCNA, FEN1 and DNA polymerase delta. In this paper, we review the evidence that RecQ helicases contribute to the impressively high level of fidelity with which genome duplication is effected

Rmi1 stimulates decatenation of double Holliday junctions during dissolution by

Expression and purification of Top3. The TOP3 gene was amplified by polymerase chain reaction (PCR) using wild type S. cerevisiae genomic DNA as a template (strain S288C, Research Genetics) and primer pairs PC3 (CTCTGAACTCGAGCTGGAAGTTCTGTTCCAGGGGCCCGCTAGCGGATCCATG AAAGTGCTATGTGTCGCAG; NheI site underlined and the sequence complementary to TOP3 in bold) and PC4 (CGCAAATCCTCGAGCCCGGGTTACATGGATGCCTTGACACGG; XhoI site underlined and the sequence complementary to TOP3 in bold). The reaction products were digested with NheI and XhoI restriction endonucleases, and cloned into NheI and XhoI sites in modified pFastBac1 vector 1, creating pFB-GST-Top3. This placed the TOP3 coding sequence downstream from sequence encoding glutathione-S-transferase (GST) and a PreScission protease cleavage site, all of which is under the control of the baculovirus polyhedron promoter. Proteins were expressed using the Bac-to-Bac expression system (Invitrogen) in Sf9 cells according to manufacturer’s recommendations. All purification steps were carried out on ice or at 4°C

Rmi1 stimulates decatenation of double Holliday junctions during dissolution by Sgs1-Top3.

A double Holliday junction (dHJ) is a central intermediate of homologous recombination that can be processed to yield crossover or non-crossover recombination products. To preserve genomic integrity, cells possess mechanisms to avoid crossing over. We show that Saccharomyces cerevisiae Sgs1 and Top3 proteins are sufficient to migrate and disentangle a dHJ to produce exclusively non-crossover recombination products, in a reaction termed "dissolution." We show that Rmi1 stimulates dHJ dissolution at low Sgs1-Top3 protein concentrations, although it has no effect on the initial rate of Holliday junction (HJ) migration. Rmi1 serves to stimulate DNA decatenation, removing the last linkages between the repaired and template DNA molecules. Dissolution of a dHJ is a highly efficient and concerted alternative to nucleolytic resolution that prevents crossing over of chromosomes during recombinational DNA repair in mitotic cells and thereby contributes to genomic integrity

BLM alleviates EcSSB inhibition of TopoIIIα, but not EcTop1, decatenase activity.

<p>(<b>A</b>) Decatenation reactions containing TopoIIIα (30 nM, lanes 2–8), EcSSB (3.2 mM, lanes 3–9), BLM (33 nM, lanes 4, 8 and 9; 66 nM, lane 5) and RMI1 (100 nM, lanes 6, 8 and 9; 200 nM, lane 7) as indicated were fractionated on a denaturing polyacrylamide gel and autoradiographed. Quantification of the decatenation products is presented in the histogram, normalized to the reactions in lane 2 (TopoIIIα alone). The percent of catenated substrate converted to circular products is indicated. (<b>B</b>) Decatenation reactions containing TopoIIIα (20 nM, lanes 2–9), RPA (200 nM, lanes 3–5 and 10), EcSSB (3.2 mM, lanes 6–8 and 10) and BLM (33 nM, lanes 4 and 7; 66 nM, lanes 5 and 8–10) as indicated were fractionated on a denaturing polyacrylamide gel and autoradiographed. Quantification of the decatenation products is presented in the histogram, normalized to the reactions in lane 2 (TopoIIIα alone). The percent of catenated substrate converted to circular products is indicated. (<b>C</b>) Decatenation reactions containing EcTop1 (6 nM, lanes 2–7), EcSSB (100 nM, lanes 3–6 and 8), BLM (17 nM, lanes 4–8) and RMI1 (75 nM, lane 5; 150 nM, lanes 6–8) as indicated were fractionated on a denaturing polyacrylamide gel and autoradiographed. Quantification of the decatenation products is presented in the histogram, normalized to the reactions in lane 2 (EcTop1 alone). The percent of catenated substrate converted to circular products is indicated.</p

BLM-RMI1 alleviates RPA inhibition of TopoIIIα decatenase activity.

<p>(<b>A</b>) Decatenation reactions containing TopoIIIα (30 nM, lanes 2–7), RPA (100 nM, lanes 3–8), BLM (33 nM, lane 4; 66 nM, lanes 5 and 9) and RMI1 (100 nM, lane 6; 200 nM, lanes 7 and 10) as indicated were fractionated on a denaturing polyacrylamide gel and autoradiographed. Quantification of the decatenation products is presented in the histogram, normalized to the reactions in lane 2 (TopoIIIα alone). The percent of catenated substrate converted to circular products is indicated. (<b>B</b>) Decatenation reactions containing TopoIIIα (15 nM, lanes 2–8), RPA (100 nM, lanes 3–6, 8 and 9), BLM (17 nM, lanes 4–9), wild type RMI1 (75 nM, lane 5; 150 nM, lanes 6, 7 and 9) and RMI1-LLTD mutant (150 nM, lanes 8 and 10) as indicated were fractionated on a denaturing polyacrylamide gel and autoradiographed. Quantification of the decatenation products is presented in the histogram, normalized to the reactions in lane 2 (TopoIIIα alone). The percent of catenated substrate converted to circular products is indicated. (<b>C</b>) Decatenation reactions containing TopoIIIα (7.5 nM, lanes 2–4), BLM (8 nM, lanes 2–4), RMI1 (38 nM, lanes 2–4) and RPA (140 nM, lane 3; 280 nM, lane 4) as indicated were fractionated on a denaturing polyacrylamide gel and autoradiographed. Quantification of the decatenation products is presented in the histogram, normalized to the reactions in lane 2 (TopoIIIα-BLM-RMI1). The percent of catenated substrate converted to circular products is indicated.</p

RPA inhibits the decatenase activity of both TopoIIIα and EcTop1.

<p>(<b>A</b>) Decatenation reactions containing TopoIIIα (30 nM, lanes 2–4) and RPA (100 nM, lane 3; 200 nM, lanes 4 and 5) as indicated were fractionated on a denaturing polyacrylamide gel and autoradiographed. Quantification of the decatenation products is presented in the histogram, normalized to the reactions in lane 2 (TopoIIIα alone). The percent of catenated substrate converted to circular products is indicated. (<b>B</b>) Decatenation reactions containing EcTop1 (6 nM, lanes 2–4) and RPA (100 nM, lane 3; 200 nM, lanes 4 and 5) as indicated were fractionated on a denaturing polyacrylamide gel and autoradiographed. Quantification of the decatenation products is presented in the histogram, normalized to the reactions in lane 2 (EcTop1 alone). The percent of catenated substrate converted to circular products is indicated.</p