Roles of Mitochondrial Dynamics under Stressful and Normal Conditions in Yeast Cells

Eukaryotic cells contain dynamic mitochondrial filaments: they fuse and divide. Here we summarize data on the protein machinery driving mitochondrial dynamics in yeast and also discuss the factors that affect the fusion-fission balance. Fission is a general stress response of cells, and in the case of yeast this response appears to be prosurvival. At the same time, even under normal conditions yeast mitochondria undergo continuous cycles of fusion and fission. This seems to be a futile cycle and also expensive from the energy point of view. Why does it exist? Benefits might be the same as in the case of sexual reproduction. Indeed, mixing and separating of mitochondrial content allows mitochondrial DNA to segregate and recombine randomly, leading to high variation in the numbers of mutations per individual mitochondrion. This opens a possibility for effective purifying selection-elimination of mitochondria highly contaminated by deleterious mutations. The beneficial action presumes a mechanism for removal of defective mitochondria. We argue that selective mitochondrial autophagy or asymmetrical distribution of mitochondria during cell division could be at the core of such mechanism

Increasing drought effects on five European pines modulate Δ13C-growth coupling along a Mediterranean altitudinal gradient.

Climate warming increases vulnerability to drought in Mediterranean water-limited forests. However, we still lack knowledge of the long-term physiological responses of coexisting pine species in these forests regarding their ability to cope with warming-induced drought stress. We investigated spatiotemporal patterns of tree performance for five isohydric pines with partially overlapping ecological niches in the eastern Iberian Peninsula along an altitudinal gradient: Pinus halepensis = P. pinaster ≤ P. nigra ≤ P. sylvestris ≤ P. uncinata. Using indexed tree-ring widths (TRWi) we assessed changes in temporal coherence of radial growth (growth synchrony, âC) over the period 1902-2011 across three elevation belts: low ≈ 1100 m; mid = 1615 m; high = 2020 m. We also examined by mixed modelling whether TRWi showed an increased coupling with leaf-level gas exchange (inferred from indexed carbon isotope discrimination, Δ13Ci) by enhanced stomatal regulation in response to an amplified regional drought stress. Increasingly negative annual water balances (decrease in annual precipitation minus evapotranspiration = -4.8 mm year−1; 1970-2011) prompted more synchronous growth of coexisting pines between low- and mid-elevation belts, with âC rising from 0.25 ± 0.04 (1902-1951) to 0.62 ± 0.05 (1962-2011). This effect was coupled with tighter stomatal regulation at mid-elevation as indicated by high correlations between TRWi and Δ13Ci (>0.60 from the mid-1970s onwards) which resembled those found at low-elevation. Simultaneously, TRWi vs. Δ13Ci uncoupling occurred at the high-elevation belt across species. Weaker growth-climate relationships as elevation increased highlighted the major role of the altitude-dependent thermal gradient in growth responsiveness to drought; however, an intensified Δ13Ci response to spring water availability across elevation belts observed from mid-1970s onwards suggested regional shifts in tree physiological activity linked to earlier seasonal drought impacts. Warming-induced drought stress is spreading to higher altitudes in Iberian pinewoods as multispecies growth is linked to progressively tighter stomatal control of water losses reflected in wood Δ13C

Role of mitochondria in the pheromone- and amiodarone-induced programmed death of yeast

Although programmed cell death (PCD) is extensively studied in multicellular organisms, in recent years it has been shown that a unicellular organism, yeast Saccharomyces cerevisiae, also possesses death program(s). In particular, we have found that a high doses of yeast pheromone is a natural stimulus inducing PCD. Here, we show that the death cascades triggered by pheromone and by a drug amiodarone are very similar. We focused on the role of mitochondria during the pheromone/amiodarone-induced PCD. For the first time, a functional chain of the mitochondria-related events required for a particular case of yeast PCD has been revealed: an enhancement of mitochondrial respiration and of its energy coupling, a strong increase of mitochondrial membrane potential, both events triggered by the rise of cytoplasmic [Ca2+], a burst in generation of reactive oxygen species in center o of the respiratory chain complex III, mitochondrial thread-grain transition, and cytochrome c release from mitochondria. A novel mitochondrial protein required for thread-grain transition is identified

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2)(−), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)–G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer

Death receptors: New opportunities in cancer therapy

© 2017 Park-media, Ltd. This article offers a detailed review of the current approaches to anticancer therapy that target the death receptors of malignant cells. Here, we provide a comprehensive overview of the structure and function of death receptors and their ligands, describe the current and latest trends in the development of death receptor agonists, and perform their comparative analysis. In addition, we discuss the DR4 and DR5 agonistic antibodies that are being evaluated at various stages of clinical trials. Finally, we conclude by stating that death receptor agonists may be improved through increasing their stability, solubility, and elimination half-life, as well as by overcoming the resistance of tumor cells. What's more, effective application of these antibodies requires a more detailed study of their use in combination with other anticancer agents

Deimination of the myelin basic protein decelerates its proteasome-mediated metabolism

© 2016, Pleiades Publishing, Ltd.Deimination of myelin basic protein (MBP) by peptidylarginine deiminase (PAD) prevents its binding to the proteasome and decelerates its degradation by the proteasome in mammalian cells. Potential anticancer drug tetrazole analogue of chloramidine 2, at concentrations greater than 1 µM inhibits the enzymatic activity of PAD in vitro. The observed acceleration of proteasome hydrolysis of MBP to antigenic peptides in the presence of PAD inhibitor may increase the efficiency of lesion of the central nervous system by cytotoxic lymphocytes in multiple sclerosis. We therefore suggest that clinical trials and the introduction of PAD inhibitors in clinical practice for the treatment of malignant neoplasms should be performed only after a careful analysis of their potential effect on the induction of autoimmune neurodegeneration processes