282 research outputs found
Beyond a Beautiful Fraud: Using a Human Rights Framework to Realize the Promise of Democracy
[Politics] is a beautiful fraud that has been imposed on the people for years . . .
-The late Honorable Shirley Chisholm\u2
The Myth of Merit: The Fight of The Fairfax County School Board and the New Front of Massive Resistance
Beyond a Beautiful Fraud: Using a Human Rights Framework to Realize the Promise of Democracy
[Politics] is a beautiful fraud that has been imposed on the people for years . . .
-The late Honorable Shirley Chisholm\u2
Recommended from our members
Is Lactate an Oncometabolite? Evidence Supporting a Role for Lactate in the Regulation of Transcriptional Activity of Cancer-Related Genes in MCF7 Breast Cancer Cells.
Lactate is a ubiquitous molecule in cancer. In this exploratory study, our aim was to test the hypothesis that lactate could function as an oncometabolite by evaluating whether lactate exposure modifies the expression of oncogenes, or genes encoding transcription factors, cell division, and cell proliferation in MCF7 cells, a human breast cancer cell line. Gene transcription was compared between MCF7 cells incubated in (a) glucose/glutamine-free media (control), (b) glucose-containing media to stimulate endogenous lactate production (replicating some of the original Warburg studies), and (c) glucose-containing media supplemented with L-lactate (10 and 20 mM). We found that both endogenous, glucose-derived lactate and exogenous, lactate supplementation significantly affected the transcription of key oncogenes (MYC, RAS, and PI3KCA), transcription factors (HIF1A and E2F1), tumor suppressors (BRCA1, BRCA2) as well as cell cycle and proliferation genes involved in breast cancer (AKT1, ATM, CCND1, CDK4, CDKN1A, CDK2B) (0.001 < p < 0.05 for all genes). Our findings support the hypothesis that lactate acts as an oncometabolite in MCF7 cells. Further research is necessary on other cell lines and biopsy cultures to show generality of the findings and reveal the mechanisms by which dysregulated lactate metabolism could act as an oncometabolite in carcinogenesis
Recommended from our members
Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs (P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses
To Study Abroad or Not to Study Abroad: That Is the STEM Question
As more science, technology, engineering and math (STEM) students consider studying abroad, it is critical for researchers and student affairs educators to know more about how students engage with the study abroad process and make decisions about whether to participate or not. This qualitative study examined the decision-making process in which STEM students engaged regarding study abroad at a STEM liberal arts college. An organizational culture lens was utilized to make meaning of the formal study abroad decision-making process within a deeply entrenched institutional bubble that permeates all college facets and stakeholders. Focus groups engaged both participants who studied abroad and those who ultimately chose not to, yielding five overarching themes: decision-making process, motivations to study abroad, college bubble, rigor, and academic issues. This study provides critical insight into understanding STEM study abroad decision-making in a unique institutional culture. Moreover, it offers student affairs educators meaningful knowledge to help support STEM students navigating the study abroad process and sheds light on the ways in which deeply entrenched institutional cultures can impact decision-making processes
Recommended from our members
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed
Case 5 : The Precision of Aid: Remembering the Forgotten Disease in the Horn of Africa
The district of Burao, Somaliland is in its 16th epidemiologic week in the midst of a cholera outbreak. The Somaliland Ministry of Health, in need of emergency relief, has requested that humanitarian organizations come to its aid. Eve Tinuviel has been deployed to Burao as a member of the Canadian Red Cross, where she serves as a global health advisor responsible for emergency health services. Eve’s main responsibility is to analyze disease surveillance data, triangulating data from different sources. A Health Cluster Coordination meeting amongst different health and humanitarian organizations reveals gaps in the epidemic response. The scarcity of resources and volunteers, and more importantly the incompleteness and inadequacy of the passive surveillance data, threaten Eve’s ability to trace newly affected individuals, identify the origins of the disease and develop strategies to help the affected communities
A Longitudinal Study of the Ethical Development of Engineering and Non-engineering Students at a National Research University
Work in progress - A Mixed-Methods Approach to Developing an Instrument Measuring Engineering Students\u27 Positive Ethical Behavior
Ethics education and the drive to produce ethical professional engineers is an important focus of one body of research on engineering education. This research often defines the positive outcome of ethics education as students and professional engineers choosing not to engage in unethical behavior. This paper discusses a portion of a larger research project and details efforts to identify and validate a definition of ethical behavior that includes the decision to engage in a positive behavior, defined as a service to a larger community. Through a series of interviews and focus groups with engineering administrators, faculty, and students, the authors attempt to confirm the construct validity of service participation as ethical behavior. They also investigate the validity of the aspects of service participation to be included as a part of a national survey on engineering ethics education practices and outcomes. They then discuss the final steps that will be taken to test and further validate the development of the service participation portion of the survey
- …