A new record of the desert truffle Picoa lefebvrei in Saudi Arabia

A new record of Picoa lefebvrei from Saudi Arabia is reported accompanied by notes on its taxonomy, ecology, and distribution

Chemotherapeutic drug targeting to lungs by way of microspheres after intravenous administration

Sibghatullah Sangi,1 Nagaraja SreeHarsha,2 Abdulhakim Bawadekji,3 Mouhanad Al Ali4 1Department of Clinical Pharmacy, Faculty of Pharmacy, Northern Border University, Rafha, Saudi Arabia; 2Department of Pharmaceutical Sciences, College of Clinical Pharmacy, King Faisal University, Al-Ahsa, Saudi Arabia; 3Department of Biological Sciences, College of Science, Northern Border University, Arar, Saudi Arabia; 4Higher Institute of Health and Bio-products of Angers (ISSBA), Angers- France, Université d’Angers, Angers, France Purpose: Currently, microsphere technology plays a major role in the development of many new cancer therapies. In the current study, we proposed a targeted drug-delivery system to improve the treatment efficacy of one of the common conventional chemotherapeutic drugs used to treat lung tumors, 5-fluorouracil (5-FU).Materials and methods: Following the preparation and optimization of small, solid microspheres, ranging in diameter between 5 and 15 µm, the final product 5-fluorouracil gelatin (5-FUG) was formulated using a Buchi Nano Spray Dryer by varying the drug:polymer ratio.Results: Particle yield was calculated as 65% ± 1.2%, and the drug content in the formulation was recorded as 74% ± 1.6%. Particle surface morphology was examined as shriveled shape (crumpled/folded); particle size distribution displayed a binomial distribution, with a mean diameter of 9.6 µm. In vitro drug release studies revealed that ~36.4% of the 5-FU in 5-FUG was released in the first hour after injection. Clinically, this would lead to initial or burst release, facilitating a quick rise to therapeutic levels. In contrast to the pure 5-FU drug (89.2% of the drug released in the first 30 minutes), 99.1% of the drug in 5-FUG was released from the spray-dried particles for a period of 12 hours. A two-compartment model was used to generate plasma concentration–time curves. 5-FUG injection has a much different distribution in vivo in contrast to intravenous injection of 5-FU. In addition, the half-life after intravenous injection of 5-FUG, t1/2(α) = 1.23 hours and t1/2(β) = 18.3 hours, was considerably longer than that of 5-FU, t1/2(α) = 0.34 hours and t1/2(β) = 8.62 hours. Examination of stained lung tissue sections showed no histopathological tissue changes or evidence of gross pathology. In addition, the optimized formulation demonstrated an increased stability under both long-term and refrigerated storage conditions.Conclusion: Our goal was to develop similar delivery systems for other chemotherapeutic drugs that are site specific to different disease models/tumor types. Keywords: spray drying, 5-fluorouracil, cancer, microspheres, targetin

First Report of Agaricus aridicola in Saudi Arabia and Ecological Notes on Agaricus bisporus

Agaricus aridicola is reported for the first time from Saudi Arabia while Agaricus bisporus is a new record for Northern region of Saudi Arabia. This study includes notes on taxonomy, ecology and distribution of both the species. It was also reported that the habitat of A. aridicola and A. bisporus are characterized by calcareous sandy soil, poor in organic matter, with presence of little amount of salinity

IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA

Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in both directions. Nucleotide sequences of ITS obtained were compared with 103 sequences of different species of desert truffles (Tirmania and Terfezia) retrieved from GenBank. The substitution model that best fit these sequences with the lowest Bayesian information criterion (BIC) was calculated. Phylogenetic relationships were inferred by the maximum-likelihood method with 1,000 bootstrap replicates to estimate the statistical significance of each node, using the algorithm Tamura-3-parameter, assuming variable substitution rates among nucleotide sites with a discrete gamma distribution (+G) of 0.43. All these analyses were performed with the MEGA 6.06 program. Both methods identified the samples as T. pinoyi (Maire) Malen\ue7on and T. claveryi Chatin. The acid-soluble protein extracts of the two mushroom samples were obtained by sonication of 5 g of freeze-dried truffle in extraction solution (10% acetic acid in phosphate saline buffer). The extracts were adjusted to a protein concentration of 200 \ub5g mL-1. The antimicrobial activity could have an interesting field of exploitation in agriculture where antibiotics are not allowed anymore in many Countries. The antimicrobial activity of the acid-soluble protein extracts was tested against Gram-positive and Gram-negative plant pathogenic bacteria. Using a double layer well-diffusion method in potato dextrose agar we observed that both extracts produced clear inhibition zones around the wells inhibiting the growth of bacterial strains of Pectobacterium carotovorum subsp. carotovorum, Pseudomonas corrugata, P. mediterranea, P. syringae pv. syringae, P. syringae pv. tomato, Xanthomonas vesicatoria, Clavibacter michiganensis subsp. nebraskensis and C. michiganensis subsp. michiganensis. The two acid-soluble protein extracts were further evaluated in liquid cultures kinetic bacterial growth assays against three bacteria species causal agents of diseases on tomato worldwide. Microbial growth was automatically determined using a Bioscreen C (Labsystems, Helsinki, Finland), which measures kinetically, the development of turbidity. Microplates were incubated at 25\ub0C with 20 s of shaking every half-hour before absorbance measurements for 48 h. Dilutions of the truffle extracts were made in Luria Broth (LB) to obtain final concentrations of 200, 100, 50, 25, 12.5, 6.25 mg mL-1. One-hundred eighty microliters of each dilution was mixed in each well of a microtiter plate with 20 \ub5l of bacterial suspension. Three replicates for each strain, truffle extract, and concentration were tested. Positive control wells for bacterial growth contained only LB. Both truffle extracts completely inhibit the bacterial growth of P. corrugata, P. syringae pv. tomato and X. vesicatoria at all dilution tested except for 6.25 mg mL-1

Hypogeous fungi in Mediterranean maquis, arid and semi-arid forests

Hypogeous fungi are common in arid and semi-arid areas of the Mediterranean basin and, in particular, they are found in Italy, Spain, northern African countries (especially in Morocco, Algeria, and Tunisia), and in the Middle East. These fungi and, in particular, some species belonging to the genus Tuber and the desert truffles (Terfezia spp. and Tirmania spp.) form ascomata of considerable economic value. In this review, a panorama of hypogeous fungal diversity and information on their ecology in Mediterranean arid and semi-arid ecosystems have been reported; their economical importance and cultivation potential are also underlined

Antibacterial Activity of Desert Truffles from Saudi Arabia Against Staphylococcus aureus and Pseudomonas aeruginosa

Medicinal mushrooms represent an unlimited source of polysaccharides with nutritional, antitumoral, antibacterial, and immune-stimulating properties. Traditional studies of epigeous higher Basidiomycetes have recently been joined by studies of hypogeous fungi and, in particular, of so-called desert truffles. With the aim to obtain novel agents against bacteria of clinical importance, we focused on the edible desert truffle mushrooms Tirmania pinoyi, Terfezia claveryi, and Picoa juniperi as sources of new antimicrobial agents. In particular, we investigated the in vitro antibacterial activity of acid-soluble protein extracts (aqueous extracts) of these 3 species against the Gram-positive human pathogenic reference strain Staphylococcus aureus ATCC 29213 and the Gram-negative strain Pseudomonas aeruginosa ATCC 15442. The acid-soluble protein extracts of T. pinoyi and T. claveryi showed minimum inhibitory concentrations of 50 \u3bcg/mL against tested pathogens. We believe that such preliminary results are promising to obtain a valuable antibiotic alternative to fight antibiotic-resistant pathogens

Hypogeous fungi in Mediterranean maquis, arid and semi-arid forests

Hypogeous fungi are common in arid and semi-arid areas of the Mediterranean basin and, in particular, they are found in Italy, Spain, northern African countries (especially in Morocco, Algeria, and Tunisia), and in the Middle East. These fungi and, in particular, some species belonging to the genus Tuber and the desert truffles (Terfezia spp. and Tirmania spp.) form ascomata of considerable economic value. In this review, a panorama of hypogeous fungal diversity and information on their ecology in Mediterranean arid and semi-arid ecosystems have been reported; their economical importance and cultivation potential are also underlined

The OPTIMA (Organization for the Phyto\u2010Taxonomic Investigation of the Mediterranean Area) Commission on Fungi

A list of proposed activities/objectives by the members of OPTIMA Commission on Fungi is here reported: Prepare a list of local names related to wild edible mushrooms (WEM); Define a provisional catalogue of macrofungi that could be characterized as typical\u2010representatives of the Mediterranean region (MR); Publish a Checklist of all macrofungi occurring in the MR; Setup of a literature database on fungi occurring in the MR; Promote studies on Mediterranean fungi to be used as food and medicine, and examine their potential in other biotechnological applications (e.g. mushroom cultivation, treatment and detoxification of wastes etc.), incl. large\u2010scale (commercial) use; Document ethnomycological knowledge in the MR (incl. traditional use of mushrooms in local communities); Prepare a list of threatened fungal species (with emphasis on those of economic importance) in the MR and adopt suitable strategies for their conservation. Assess invasion and determine possible risks from alien species. Examine existing legislation and regulations on harvesting of WEM and on quality of fungal products; Promote mycological education and disseminate fungal\u2010related knowledge in a wider audience; Examine existing protocols used for various experimental purposes in fungal taxonomy (e.g. molecular systematics, phylogeny, chemotaxonomy, characterization of secondary metabolites, proximate analyses, etc.) and possibly adopt common improved approaches/techniques to deal with pertinent issues; Examine the possibilities for networking the Institutions of participating members in order to seek and obtain funding from the E.U. or other national and international Organizations. Assess the potential of collaboration with other Societies, SME's and/or NGO's having pertinent interests and priorities

Local names for common wild edible mushrooms growing in Europe, North Africa and the Kingdom of Saudi Arabia

Mushroom hunters in rural areas call and identify wild edible mushrooms on the basis of their local or common names. Local names of mushrooms are also widely used in folk medicine and particularly in shamanic and religious rituals. Linking of local names with their respective scientific names is of fundamental importance for the exploitation of their market potential and for prevention of poisoning. We present a list of common names given to 45 wild edible mushroom taxa (28 basidiomycetes and 17 ascomycetes) occurring in Austria, the Czech Republic, France, Greece, Italy, the Kingdom of Saudi Arabia, Morocco, Romania, Serbia, and Spain. The selected taxa are Agaricus campestris., A. crocodilinus, Amanita caesarea, Boletus aereus, B. edulis, B. pinophilus, B. reticulatus, Calocybe gambosa, Calvatia gigantea Cantharellus cibarius, Craterellus cinereus, C. cornucopioides, C. tubaeformis, Cyclocybe cylindracea, Delastria rosea, Hydnum repandum, Infundibulicybe geotropa, Lactarius deliciosus, L. salmonicolor, L. sanguifluus, L. semisanguifluus, Macrolepiota procera, Morchella elata, Picoa juniperi, P. lefebvrei, Pleurotus eryngii, P. eryngii var. ferulae, P. nebrodensis, P. ostreatus, Podaxis pistillaris, Russula cyanoxantha, R. virescens, Terfezia arenaria, T. boudieri, T. claveryi, T. leptoderma, Tirmania nivea, T. pinoyi, Tuber aestivum, T. asa, T. borchii, T. brumale, T. magnatum, T. melanosporum, and T. oligospermum. The national and the regional common names (if known) are also reported