PENGARUH KUALITAS PELAYANAN DAN PERSEPSI MANFAAT KOPERASI TERHADAP PARTISIPASI ANGGOTA KOPERASI PEDAGANG PASAR (KOPPAS) KECAMATAN PASAR MINGGU, JAKARTA SELATAN

ABSTRACT HERMANSYAH. The Iinfluence of Service Quality and The Perception of Cooperative`s Benefit To The Participation Of Member of Koperasi Pedagang Pasar (KOPPAS) in Distric of Pasar Minggu, South of Jakarta. Faculty of Economics, State University of Jakarta, 2014. . This study aims to determine how much the influence of service quality and perception of cooperative`s benefit to the participation of member of Koperasi Pedagang Pasar (KOPPAS) in Distric of Pasar Minggu, South of Jakarta. The method of study used survei method with correlation approach. Study population are members of cooperative as many as 278 people. Then taken 69 members as sample. All of variables of this study are revealed have normal distribution and assumes linierity. Multiple linierity regression equation obtained . Simultaneous regression coefficient test (test F) showed that there is influence simultaneously between variable of service quality (X1) and perception of benefit (X2) of cooperative to the participation of cooperative members (Y) by seeing the decision criteria F count 18,540 > F table 3,316. while the partial regression coefficient test (t Test) showed that each of independent variables has the influence to the dependent variables. That can be seen in the decision criteria each variable where t count service quality variabel (X1) amounts 2,212 and the cooperative is benefit perception amounts 3,761 > t table which amount to 1,997. Determination coefficient test showed that the participation of member Koperasi Pedagang Pasar (KOPPAS) simultaneously influence by quality service variable and the perception of cooperative is benefit that can be seen in the value of determination that amounts to 0,360 or 36% the percentage of influences of both independent variables, while the remaining percentage is influenced by other factors. From the above study, it can give the result that there are the influence of service quality and the perception of cooperative is benefit to the participation of members of Koperasi Pedagang Pasar (KOPPAS) in District of Pasar Minggu, South of Jakarta

Transcription of Cell Wall Mannoproteins-1 gene in Saccharomyces cerevisiae Mutant

Protein phosphatase (PPases) are enzymes to catalyze the phosphate groups removal from amino acid residues of proteins by protein kinases.  The PPG1, one of PPases in Saccharomyces cerevisiae has less information in function/role.  In this research, the disruption of DPPG1::CgHIS3 in FY833 genetic background was successfully constructed by PCR-mediated disruption strategies using pCgHIS3 (EcoRI-HindIII) (=pYMS314) (pUC19 base) and primer pair of PPG1, forward (41 to 100) and reverse (1048 to 1101).  A BamHI - BamHI fragment 3,28 kb DPPG1::CgHIS3 consisting of 1 kb upstream PPG1+ 1.78 kb CgHIS3 + 0.5 down stream of PPG1) was confirmed using PCR and detected using electrophoresis. Phenotypic assay of DPPG1::CgHIS3 in FY833 and did not show 200mg/ml Calco fluor sensitivity, while another mutant DPPG1::CgHIS3 in W303-IA show 100mg/ml congo red sensitivity. Furthermore, to confirm whether DPPG1 could increase a CWP1 transcriptional level was performed Real Time (RT) PCR analysis using Primer pair Kf (AATTCGGCCTGGTGAGTATCC) and Kr (GTTTCAAAGTGCCGTTATCACT GT). RT-PCR’s data showed that transcriptional level of CWP1 in DPPG1::CgHIS3 changed less than two-folds comparing with in wild type strain. This result indicated that disruption of PPG1 in S.cerevisiae did not change CWP1 transcriptional level significantly. 

MANUSKRIP ACEH: REVITALISASI KEARIFAN MASYARAKAT ACEH DI ERA GLOBAL

Tahun 2004 menjadi titik balik Aceh berbenah dan bangkit dari keterpurukan.Pasca bencana alam (gempa-tsunami) dan bencana kemanusiaan (kon ik)menuntun adanya proses rehabilitasi dan rekonstruksi yang dilakukan olehPemerintah Daerah, Indonesia dan pihak asing (luar negeri) dalam berbagai bidangturut menumbuhkan perekonomian dan sosial masyarakat Aceh dengan pesat.Proses itu tidak hanya fokus di infrastruktur, akan tetapi juga di bidang sosialkeagamaan dan cagar budaya, serta mempengaruhi pola pikir dan cara pandanggenerasi sekarang.Sebagai daerah kaya potensi alam dan mewariskan nilai sejarah dan budayamasa lampau, Aceh bergulir dalam beragam cuaca politik dan kebijakan, mulaidari periode kesultanan, kolonial, hingga kemerdekaan Indonesia. Pergolakan danpeperangan panjang juga menghiasi tiga periode tersebut di Aceh, baik pertikaianinternal, perang saudara, maupun kon ik vertikal dan horizontal. Akibatnya,cagar budaya dan kearifan masyarakat terkubur oleh bencana kemanusia tersebut,terlebih “kekayaan alam dan kearifan” musnah saat bencana alam terbesar terjadidi abad ke-21

Dayak and Malay Brotherhood in the Malay Collective Memory of Post-Independence Indonesia

Each community in the world has a past in which their existence is commonly determined by things happening in their past. To preserve their past a community needs means of transmission, among others, through oral traditions such as stories, mantra, and way of life. They inherit stories, mantra, and ways of life with values that have related meanings to their life. The heritage of these things is very important to preserve and develop the collective identity of the community. As they continue to be passed down, they become the collective memory of a community. The West Kalimantan Malay society has collective memories that are relatively inherited in the form of oral traditions and other life practices such as cultivation. Part of the collective memory has awakened them to the brotherhood with the people called Dayak today. Nevertheless, the collective memory is confronted with challenges both coming from within themselves and from the outside that may eliminate them without a better replacement

ISLAM AND LOCAL CULTURE IN INDONESIA

Muslims believe that their religion is universal, suitable to all places and time. Consequently, in practice, Islam can be adapted to various situations and conditions. Therefore, the diversity in Islam is inevitable. Diversity is especially related to aspects of interpretation and religious branches, not things that are principle. This article is about the relationship between Islam and local culture. As recognized by many experts, Islam in Indonesia was spread by peaceful means. Local elements were used in the process of Islamization. As a result, Islam could be accepted by most of society of Indonesia. Islam expressed here shows a distinctive face. Islam can live hand in hand with local culture, especially the culture that is not incompatible with Islam. Keywords: Islam, Islamization, local culture, diversity

Islam dan Toleransi Beragama dalam Masyarakat Muslim Kanayatn Dayak di Kalimantan Barat

The object of this study is Islam in Dayak communities; a subject that is rarely being studied. It tries to expose some interesting facts about Islam in these isolated communities. Many have hitherto thought that the Dayak communities are primitive with no particular affiliation to any formal religion. This paper tries to show the reverse. The truth is that these communities do even have reasonably developed view of Islam especially that which has to do the problem of tolerance and social life. The basic premise that this paper adopts is that a practice is form of paradigm; the way a particular society performs social life reflects their orientation of religious understanding. Hence, although the Dayak communities do not have paradigmatic understanding of Islam?in the strictest sense of the word?they do nonetheless have a practical discourse that emerge out of their unique and perhaps simple understanding of their religion. Relevant to the study of this object is the issue of community identity and how this issue is related to the religious identity. Hence, the paper is interested in exposing the tension between the two identities in the context of the Dayak communities in West Kalimantan