Glycyrrhiza uralensis is widely used in Chinese herbal compound prescriptions. Itcontains various natural active components, among them glycyrrhizic acid is believed tobe the main effective constituent. The biosynthetic pathway of glycyrrhizic acid iscontrolled and regulated by many different enzymes. In our studies two functional genescoding 3-hydroxy-3-methylglutary CoA reductase (HMGR) and squalene synthase (SQS)were selected as target genes. Several kinds of polymorphism were discovered in thecDNA sequences and amino acid sequences of the two genes, and which inflected thelevel of glycyrrhizic acid in G. uralensis

Gao, Ya

Li, Wendong

Liu, Chunsheng

Liu, Ying

Wen, Hao

Yang, Rui

English

Update Publishing (E-Journals)

Research in Plant Biology, 3(6): 23-30, 2013                             ISSN : 2231-5101  www.resplantbiol.com   Regular Article  Analysis of functional gene polymorphism in Glycyrrhiza uralensis  Ying Liu1, Wendong Li2, Hao Wen1, Ya Gao1, Rui Yang1, Chunsheng Liu1*  1School of Chinese Pharmacy, Beijing University of Chinese Medicine, Beijing, China 2 Department of Antibiotic, Beijing Institute for Drug Control, Beijing, China  Glycyrrhiza uralensis is widely used in Chinese herbal compound prescriptions. It contains various natural active components, among them glycyrrhizic acid is believed to be the main effective constituent. The biosynthetic pathway of glycyrrhizic acid is controlled and regulated by many different enzymes. In our studies two functional genes coding 3-hydroxy-3-methylglutary CoA reductase (HMGR) and squalene synthase (SQS) were selected as target genes. Several kinds of polymorphism were discovered in the cDNA sequences and amino acid sequences of the two genes, and which inflected the level of glycyrrhizic acid in G. uralensis.  Key words: Glycyrrhiza uralensis; HMGR, SQS, gene polymorphism, glycyrrhizic acid  Glycyrrhiza uralensis Fisch. (Gancao in Chinese) is widely used in Chinese herbal compound prescriptions. Based on traditional Chinese medicine theory, G. uralensis was believed to have the functions of nourishing qi, relieving coughing, alleviating pain, tonifying spleen and eliminating phlegm (Zeng et al. 1988, State Pharmacopoeia Committee 2010). The reason why G. uralensis has these potent effects and wide applications is that it contains lots of natural active components, including more than 20 categories of triterpenoids and approximately 300 categories of flavonoids. Many modern clinic studies have reported that G. uralensis possesses various biological activities, such as anti-bacterial (Ai-Turki et al. 2008, Park et al. 2008, Bodet et al. 2008), anti-inflammatory (Cheng et al. 2008, Sun and Pan 2006, Wu et al. 2011), anti-tumor (Tatsuzaki et al. 2007, Park et al. 2009, Lee et al. 2008) and antiviral activities (Romero et al. 2005, Sasaki et al. 2002-2003, Cinatl et al. 2003). Besides the medicinal value, G. uralensis is also used as food corrective agents and tobacco additives in China.  The very large demand of G. uralensis has caused the irresponsible excessive exploitation of wild G. uralensis resources. In 2000, the Chinese government had to impose restrictions on the collection of wild G. uralensis. As a result cultivars have become the main resource of this herb in Chinese herbal medicine markets. However, the content of glycyrrhizic acid in most of cultivars can not accord with the minimum standard (2%) in Chinese pharmacopoeia. Consequently improving the quality of cultivars of G. uralensis has become the key issue of the sustainable development. We think it is interesting and meaningful to solve this problem by genetic engineering. Among all the active components in G. Ying Liu et al. / Research in Plant Biology, 3(6): 23-30, 2013  24  uralensis, glycyrrhizic acid is believed to be the main effective constituent and treated as an indicator component to characterize the quality of this Chinese herb. Up to now the biosynthetic pathway of glycyrrhizic acid has been clarified (Fig. 1), which is controlled and regulated by many enzymes, among them two enzymes (marked in red in Fig. 1) are very important. 3-hydroxy-3-methylglutary CoA reductase (HMGR) is the first rate-limiting enzyme in this metabolic pathway, it catalyzes HMG-CoA and NADPH into MVA, which is an irreversible reaction (Harker et al. 2003, Aquil et al. 2009). Squalene synthase (SQS) lies in the branch point from FPP to triterpenoids or other products, and when positively regulated it can help the synthesis of triterpenoids (Lu et al. 2008). Therefore in our present studies the cDNAs coding the above two enzymes were cloned and the polymorphism of them were observed. It was also found that the functional gene polymorphism inflected the level of glycyrrhizic acid. Gene variations can cause the differences in enzyme activity and expression and finally lead to the differences in level of metabolites. The influence of functional gene polymorphism on metabolic pathway is especially significant, which has been studied in the field of medical science and drug screening (Ozaydin et al. 2010, Sugimoto et al. 2007, Deng et al. 2011). However, reports about the influence of functional gene polymorphism on the accumulation of glycyrrhizic acid in G. uralensis are very infrequent. We hope our studies can do some help to reveal the relation between functional genes and the content of glycyrrhizic acid.  Fig. 1 Biosynthetic pathway of glycyrrhizic acid Ying Liu et al. / Research in Plant Biology, 3(6): 23-30, 2013  25   Materials and methods Plant material and RNA extraction  The roots of G. uralensis were collected from the herb garden in Beijing University of Chinese Medicine, Beijing, China. Samples were immersed in liquid nitrogen during the field collection and identified by Prof. Liu Chun-sheng (Beijing University of Chinese Medicine). Total RNA was extracted from approximately 1g fresh tissue using the “Trizol” reagent (Beijing MeiLaiBo medical technology Co., LTD), following the manufacturer’s instructions. Final RNA concentrations were determined by spectrophotometry and their integrity was examined by electrophoresis in 1% (w/v) agarose gel.  Molecular cloning of HMGR cDNA from G. uralensis  Single-stranded cDNA was synthesized from 12µL of total RNA using the primers oligo (dT) and reverse transcriptase M-MLV (Takara) in 50µL reactions, following the manufacturer’s instructions. After aligning HMGR sequences of Leguminous plant recorded in Genbank (accession number: XM003612517.1 and GI357484554), the amplification step was performed using primers HMGR-F1 (5’-GGG TCG GAA AAT GGA CGT-3’) and HMGR-R1 (5’-GGA GGC TTT CGT TAT TGG TC-3’) designed using conserved regions. The cycling parameters were as follows: 94°C for 5min; 35cycles of 94°C for 30sec, annealing at 57°C for 30sec, extension at 72°C for 2min; a final extension at 72°C for 7min. The amplified fragments were subcloned into pMD19-T, and the recombinant plasmids HMGR-T were obtained, which were transformed into disarmed E.coli DH5α cells, and DNA sequencing was carried out by Shanghai Sangon biological technology co., LTD.  Molecular cloning of SQS cDNA from G. uralensis Based on the SQS cDNA sequences recorded in Genbank (AM182329 and D86409), the primers were designed using conserved regions (Table 1). The cycling parameters were as follows: 94°C for 5min; 35cycles of 94°C for 30sec, annealing at 57°C for 30sec, extension at 72°C for 90sec; a final extension at 72°C for 10min. The amplified fragments were subcloned into pMD19-T, and the recombinant plasmid SQS1-T and SQS2-T were obtained, which were transformed into disarmed E.coli DH5α cells, and DNA sequencing was carried out by Shanghai Sangon biological technology co., LTD.  Table 1 Primer pairs used in this paper Gene Primer Sequence (5’-3’) SQS1 SQS-1F ATGGGGAGTTTGGGAGCGAT SQS-1R CGTGTTTGACCATTCGTTTC SQS2 SQS-2F ATGGGGAGTTTGGGAGCGAT SQS-2R CTAGTTATTTTGGCGGTTGGCAG  Bioinformatics analysis of HMGR and SQS in G. uralensis The obtained HMGR sequences and SQS sequences were aligned using BLAST on the website NCBI, ORF Finder was used to look for the open reading frame. DNAclub was used to analyze the polymorphism of amino acid sequences.  Results and discussion Polymorphism of HMGR gene in G. uralensis Twelve different cDNA sequences (No. 1~ No. 12) coding 3-hydroxy-3-methylglutary CoA reductase were obtained from different G. uralensis plants. The mutations in the twelve HMGR cDNA sequences were listed in Table 2. Based on Table 2, it was determined that single nucleotide polymorphism (SNPs) appeared in 17 Ying Liu et al. / Research in Plant Biology, 3(6): 23-30, 2013  26  different sites, and insertion deletion length polymorphism (InDel) appeared between 74 ~ 79 bp. The mutations in the relevant amino acid sequences were listed in Table 3. It was determined that missense mutation appeared in three different sites (62, 167, 229), deletion and insertion mutation appeared between 25th ~ 26th residue. The following enzymatic reaction experiments showed that the insertion mutation (glycine and alanine in 25 ~ 26 site) was beneficial to the accumulation of glycyrrhizic acid.  Table 2 The mutations in different HMGR cDNA sequences of G. uralensis Sequences Mutation sites (bp) 72 74-79 81 99 185 432 465 500 544 1 C - C G T G T C T 2 C - G A A G C C C 3 C - G A A A T C C 4 C - G A A G C C C 5 C - G A A G C C C 6 C CTGGCG G A A G C C C 7 C CTGGCG C G T G T T C 8 T - C A A A T C C 9 C  G G A A T C C 10 C CTGGCG C G T G T C C 11 T - C G A A T C C 12 C - G A A G/A C/T C C Sequences Mutation sites (bp) 669 685 792 900 1008 1089 1389 1509 1709 1 G G A G G T T G T 2 A T A A G T A A C 3 A G G G G C T A C 4 A G A G G T A A T 5 A T A G G T A A T 6 A T A G G T A A C 7 G G G G A T A T T 8 A G G G G C T A T 9 A G G G G C T A T 10 G G G G G T A A T 11 A G G G G C T A T 12 A G A/G G G T/C A A T  Table 3 Mutations in different HMGR amino acid sequences of G. uralensis Sequences Mutation sites (amino acid residues) 25-26 62 167 229 1 deletion His (H) Ser (S) Leu (L) 2 deletion His (H) Ser (S) Leu (L) 3 deletion His (H) Ser (S) Val (V) 4 deletion His (H) Ser (S) Val (V) 5 deletion His (H) Ser (S) Leu (L) 6 Glycine (G) alanine (A) Leu (L) Leu (L) Val (V) 7 Glycine (G) alanine (A) Leu (L) Ser (S) Val (V) 8 deletion His (H) Ser (S) Val (V) 9 deletion His (H) Ser (S) Val (V) 10 Glycine (G) alanine (A) Leu (L) Leu (L) Val (V) 11 deletion His (H) Ser (S) Val (V) 12 deletion His (H) Ser (S) Val (V)  Ying Liu et al. / Research in Plant Biology, 3(6): 23-30, 2013  27   Polymorphism of SQS gene in G. uralensis SQS gene belongs to a multigene family, up to now two kinds of SQS genes with different expressing activities have been found in many plants, such as Arabidopsis thaliana (Mirjalili et al, 2011, Kribii et al. 1997) and Glycyrrhiza glabra (Hiroaki et al. 2003).In our studies twelve different SQS1 cDNA sequences and five different SQS2 cDNA sequences were obtained. For SQS1 cDNA sequences, comparing with the conservative sequence (Genbank: HM012825) there were four kinds of polymorphism, including SNPs, InDel, nonsense mutation and alternative splicing (AS). SNPs appeared in 22 different sites (Table 4), the ratio of missense mutation was about 80.9%. InDel appeared between 738 ~ 740 bp, 3 basic groups (GGA) was missing, which led to the deletion of one amino acid residue. Nonsense mutation appeared in 1231 bp, C mutated into T. In one SQS1 cDNA sequence, a 15 bp fragment was inserted between 1036 ~ 1051 bp, and in another SQS1 cDNA sequence, a 76 bp fragment was deleted between 329 ~ 404 bp (Fig 2). These polymorphism both belonged to AS, the former was intron retention and the latter was exon skipping. For SQS2 cDNA sequences, there was only one kind of polymorphism, SNPs (Table 4). It appeared in 9 different sites, and the ratio of missense mutation was about 55.5%.  Table 4 SNPs in SQS1 and SQS2 cDNA sequences of G. uralensis  Mutation types Mutation sites (bp)   SQS1 A/G transition 98, 250, 425, 436, 689, 922, 984 C/T transition 23, 385, 495, 502, 1052,1117, 1118, 1231 C/G transversion 1121 T/G transversion 606 A/T transversion 314, 374, 1159 A/C transversion 98, 718  SQS2 A/G transition 63, 520, 898 C/T transition 396, 513, 660, 1210 C/G transition 741 A/T transversion 1177    Fig. 2 Alternative splicing appeared in SQS1 cDNA sequences of G. uralensis  All the cDNA sequences were translated into amino acid sequences by DNAclub, 17 different mutations were discovered in the amino acid sequences of SQS1 (Table 5) and 5 different mutations were discovered in the amino acid sequences of SQS2 (Table 6). In the following enzymatic reactions it was found that the catalytic efficiency of different recombinant SQS1 protein was different, Ying Liu et al. / Research in Plant Biology, 3(6): 23-30, 2013  28  which was influenced by conservative substitution obviously, but the catalytic efficiency of different recombinant SQS2 protein was similar to each other, which declared that the polymorphism of SQS2 could not change the enzyme activity.  Table 5 The mutations in SQS1amino acid sequences of G. uralensis Mutation sites (amino acid residue) Before the mutation After the mutation type 8 Val (V) Ala (A) Conservative substitution 33 Ala (A) Glu (E)/Gly (G) Non-conservative substitution 84 Ser (S) Gly (G) Non-conservative substitution 105 Val (V) Asp (D) Non-conservative substitution 125 Val (V) Asp (D) Non-conservative substitution 129 Phe (F) Leu (L) Conservative substitution 142 Asn (N) Ser (S) Conservative substitution 146 Arg (R) Gly (G) Non-conservative substitution 168 Tyr (Y) His (H) Non-conservative substitution 230 Arg (R) Gln (Q) Non-conservative substitution 240 Leu (L) Ile (I) Conservative substitution 308 Arg (R) Gly (G) Non-conservative substitution 328 Met (M) Ile (I) Conservative substitution 351 Pro (P) Leu (L) Conservative substitution 373 Leu (L) Pro (P)/Ser (S) Non-conservative substitution 374 Ser (S) Thr (T) Conservative substitution 387 Asn (N) Tyr (Y) Conservative substitution  Table 6 The mutations in SQS2 amino acid sequences of G. uralensis Mutation sites (amino acid residue) Before the mutation After the mutation type 174 Gly (G) Arg (R) Non-conservative substitution 247 Asp (D) Glu (E) Conservative substitution 330 Asp (D) Gly (G) Non-conservative substitution 393 Phe (F) Ile (I) Conservative substitution 404 Tyr (Y) His (H) Non-conservative substitution  It is well known that the metabolic pathway of glycyrrhizic acid is very complex, which is regulated and controlled by many enzymes. HMGR and SQS are only two of them. We just hope our work can provide a basis for further studies concerned with exploring the biosynthesis of glycyrrhizic acid in vitro and strengthening the efficacy of G. uralensis by improving the content of glycyrrhizic acid. There are still lots of interesting work waiting us to do.  Acknowledgements   This work was supported by National Nature Science Fund (81072988), Beijing Project for Young Talents and The Independent Subject of Beijing University of Chinese Medicine.  References Ai-Turki, A.I., Ei-Ziney, M.G., Abdel-Salam, A.M. 2008. Chemical and anti-bacterial characterization of aqueous extracts of oregano, marjoram, sage and licorice and their application in milk and labneh. J Food Agr Env. 6 (1): 39-47.  Aquil, S., Husaini, A.M., Abdin, M.Z., Rather, G.M. 2009. Overexpression of the HMG-CoA reductase gene leads to Ying Liu et al. / Research in Plant Biology, 3(6): 23-30, 2013  29  enhanced artemisinin biosynthesis in transgenic Artemisia annua plants. Planta Med. 75 (13): 1453-1458.  Bodet, C., La, V.D., Gafner, S., Bergeron, C., Grenier, D. 2008. A licorice extract reduces lipopolysaccharide- induced proinflammatory cytokine secretion by macrophages and whole blood. J Periodontolo. 79 (9): 1752-1761. Cheng, A.W., Wan, F.H., Wang, J.Q., Jin, Z.Y., Xu, X.M. 2008. Macrophage immuno-modulatory activity of polysaccharides isolated from Glycyrrhiza uralensis Fisch. Int Immunopharmacol. 8 (1): 43-50.  Cinatl, J., Morgenstern, B., Bauer, G., Chandra, P., Rabenau, H., Doerr, H.W. 2003. Glycyrrhizin, an active component of liquorice roots, and replication of SARS-associated coronavirus. Lancet. 361 (9374): 2045-2046.  Deng, H., Liu, F., Pan, Y. 2011. Bsm I, Taq I, Apa I and Fok I polymorphisms in the vitamin D receptor gene and periodontitis ameta-analyses of 15 studies including 1338 cases and 1302 controls. J Clin Periodontol. 38(3): 199-207. Lee, S., Oh, M.M., Lim, W.B., Choi, E.J., Park, Y.N., Kim, J.A., Choi, J.Y., Hong, S.J., Oh, H.K., Son, J.K., Lee, S.H., Kim, O.J., Choi, H.R., Jun, C.D. 2008. Gene induction by glycyrol to apoptosis through endonuclease G in tumor cells and prediction of oncogene function by microarray analysis. Anticancer Drugs. 19 (5): 503-515.  Harker, M., Holmberg, N., Clayton, J.C., Gibbard, C.L., Wallace, A.D., Rawlins, S., Hellyer, S.A., Lanot, A. Safford, R. 2003. Enhancement of seed phytosterol levels by expression of an N-terminal truncated Hevea brasiliensis (rubber tree) 3-hydroxy-3-methylglutaryl-CoA reductase. Plant Biotechnol J. 1: 113–121.  Hiroaki, H., Pengyu, H., Kenichiro, I. 2003. Up-regulation of soyasaponin biosynthesis by methyl jasmonate in cultured cells of Glycyrrhiza glabra. Plant Cell Physiol. 44(4): 404-411.  Kribii, R., Arro, M., Arco, A.D., Gonzalez, V., Balcells, L., Delourme, D., Ferrer, A., Karst, F., Boronat, A. 1997. Cloning and characterization of the Arabidopsis thaliana SQS1 gene encoding squalene synthase. Eur. J. Biochem. 249: 61-69.  Lu, H.Y., Liu, J.M., Zhang, H.C., Yin, T., Gao, S.L. 2008. Ri-mediated transformation of Glycyrrhiza uralensis with a squalene synthase gene (GuSQS1) for production of glycyrrhizin. Plant Mol Biol Rep. 26: 1-11.  Mirjalili, M.H., Moyano, E., Bonfill, M., Cusido, R.M., Palazon, J. 2011. Overexpression of the Arabidopsis thaliana squalene synthase gene in Withania coagulans hairy root cultures. Biologia plantarum. 55(2): 357-360.  Ozaydin, E., Dayangae, E.D., Erdern, Y.H. 2010. The relationship between vitamin D receptor gene polymorphisms and bone density, osteocalcin level and growth in adolescents. J Pediatr Endocrinol Metab. 23(5): 491-496.  Park, I., Park, K.K., Park, J.H., Chung, W.Y. 2009. Isoliquiritigenin induces G2 and M phase arrest by inducing DNA damage and by inhibiting the metaphase / anaphase transition. Cancer Lett. 277 (2): 174-181.  Park, I.K., Kim, J., Lee, Y.S., Shin, S.C. 2008. In vivo fungicidal activity of medicinal plant extracts against six phytopatho- genic fungi. Int J Pest Manag. 54 (1): 63-68.  Romero, M.R., Efferth, T., Serrano, M.A., Castano, B., Macias, R.I., Briz, O., Marin, J.J. 2005. Effect of artemisinin/artesunate as inhibitors of hepatitis B virus production in an “in vitro” replicative system. Antiviral Res. 68(1): 75-83. Sasaki, H., Takei, M., Kobayashi, M., Pollard, R.B., Suzuki, F. 2002-2003. Effect Ying Liu et al. / Research in Plant Biology, 3(6): 23-30, 2013  30  of glycyrrhizin, an active component of licorice roots, on HIV replication in cultures of peripheral blood mononuclear cells from HIV- seropositive patients. Pathobiology. 70 (4): 229-236.  State Pharmacopoeia Committee. 2010. Pharmacopoeia of China, Part I. Chemical Industry Press, Beijing, pp: 80-81. Sugimoto, M., Furuta, T., Shirai, N. 2007. Effects of interleukin-10 gene  poly- morphism on the development of gastric cancer and peptic ulcer in Japanese subjects. J Gastroenterol Hepatol. 22(9): 1443-1449.  Sun, H.X. and Pan, H.J. 2006. Immunological adjuvant effect of Glycyrrhiza uralensis saponins on the immune responses to ovalbumin in mice. Vaccine. 24 (11): 1914-1920.  Tatsuzaki, J., Taniguchi, M., Bastow, K.F., Nakagawa-Goto, K., Morris-Natschke, S.L., Itokawa, H. Baba, K. Lee, K.H. 2007. Anti-tumor agents 255: novel glycyrrhetinic acid-dehydrozingerone conjugates as cytotoxic agents. Bioorg Med Chem. 15 (18): 6193-6199.  Wu, T.Y., Khor, T.O., Saw, C.L., Loh, S.C., Chen, A.I., Lim, S.S., Park, J.H., Cai, L., Kong, A.N. 2011. Anti-inflammatory / anti-oxidative stress activities and differential regulation of Nrf2-mediated genes by non-polar fractions of tea Chrysanthemum zawadskii and licorice Glycyrrhiza uralensis. AAPS Journal. 13 (1): 1-13.  Zeng, L., Li, S.H., Lou, Z.C. 1988. Morphological and histological studies of Chinese licorice. Acta Pharm Sin. 23: 200-208.   

Analysis of functional gene polymorphism in Glycyrrhiza uralensis

https://updatepublishing.com/journal/index.php/ripb/article/download/2492/2470

Analysis of functional gene polymorphism in Glycyrrhiza uralensis

Abstract

Similar works

Full text

Available Versions

Update Publishing (E-Journals)