DUBIELA, C. R.

EIRAS, M.

FAJARDO, T. V. M.

NICKEL, O.

SOUTO, E. R.

Repository Open Access to Scientific Information from Embrapa

2127Detection and partial molecular characterization of Grapevine fleck virus, Grapevine virus D...Ciência Rural, v.42, n.12, dez, 2012.Ciência Rural, Santa Mari , v.42, n.12, p.2127-2130, dez, 2012ISSN 0103-8478Thor  Vinícius  Martins  FajardoI*   Marcelo  EirasII   Osmar  NickelI   Carla  Rosa  DubielaIIIEliezer  Rodrigues  de  SoutoIIIDetection and partial molecular characterization of Grapevine fleck virus, Grapevine virusD, Grapevine leafroll-associated virus -5 and -6 infecting grapevines in BrazilDetecção  e  caracterização  molecular  parcial  de  Grapevine  fleck  virus,  Grapevine  virus  D,  Grapevineleafroll-associated  virus  -5  e  -6  que  infectam  videiras  no  BrasilReceived 05.30.12   Approved 08.06.12   Returned by the author 09.18.12CR-0342.R1ABSTRACTGrapevine fleck, rugose wood and leafroll are threegrapevine viral diseases whose causal agents (or associatedviruses) respectively are Grapevine fleck virus (GFkV), Grapevinevirus D (GVD) and Grapevine leafroll-associated virus 5 and 6(GLRaV-5 and -6). The objective of this work was to perform apartial molecular characterization of local isolates of these fourviral species that infect grapevines. The nucleotide and deducedamino acid sequences of complete genes of the coat protein(CP) (of GFkV), the CP and the RNA binding protein (of GVD),the CP and the partial hHSP70 gene (of GLRaV-5) and thepartial hHSP70 gene (of GLRaV-6) were aligned and comparedin silico with other isolates. These data extend the availableinformation about Brazilian isolates of GFkV, GLRaV-5 and -6,and reports for the first time the GVD occurrence in Brazil.Key words: diagnosis, sequencing, Maculavirus, Vitivirus,Ampelovirus, Vitis.RESUMOMancha das nervuras, lenho rugoso e enrolamentodas folhas são três doenças virais da videira, cujos agentescausais (ou vírus associados) são o Grapevine fleck virus (GFkV),o Grapevine virus D (GVD) e os Grapevine leafroll-associatedvirus 5 e 6 (GLRaV-5 e -6), respectivamente. O objetivo destetrabalho foi realizar a caracterização molecular parcial deisolados locais dessas quatro espécies virais que infectamvideira. As sequências de nucleotídeos e de aminoácidosdeduzidos dos genes completos da proteína capsidial (CP) (doGFkV), da CP e da RNA binding protein (do GVD), da CP doGLRaV-5 e parte do gene codificador da hHSP70 do GLRaV-5 e -6 foram alinhadas e comparadas in silico com sequênciasde outros isolados. Os dados obtidos expandem a informaçãoexistente sobre isolados brasileiros de GFkV, GLRaV-5 e - 6 erelatam pela primeira vez a ocorrência do GVD no Brasil.Palavras-chave: diagnose, sequenciamento, Maculavirus,Vitivirus, Ampelovirus, Vitis.At least fifty-eight virus species arerecognized to infect grapevine (Vitis spp.) (MARTELLI,2009). Grapevine fleck is a graft-transmissible diseaseof grapevine, caused by Grapevine fleck virus (GFkV),a phloem-limited and non-mechanically transmissiblevirus. GFkV possesses isometric particles ca. 30 nm indiameter and is the type member of the genusMaculavirus in the family Tymoviridae (MARTELLI,2009). The viral genome is a positive-sense, single-stranded RNA with a genome size of 7,564 nucleotides(nt). GFkV causes latent infections in V. viniferacultivars, but induces specific foliar symptoms in theindicator host V. rupestris (SABANADZOVIC et al.,2001). The complete nucleotide (nt) sequence of theGFkV (Italian isolate) was obtained bySABANADZOVIC et al. (2001). Posteriorly, FAJARDOet al. (2004) performed a partial characterization of theviral replicase gene of GFkV isolate from Brazil.The rugose wood (RW) complex affectsgrapevines woody cylinder causing pitting and/orgrooving in the region under the plant bark. Mostrootstock/scion combinations express wood symptomsIEmbrapa Uva e Vinho, 95700-000, Bento Gonçalves, RS, Brasil. E-mail: thor@cnpuv.embrapa.br. *Autor para correspondência.IIInstituto Biológico de São Paulo, São Paulo, SP, Brasil.IIIDepartamento de Agronomia, Universidade Estadual de Maringá (UEM), Maringá, PR, Brasil.- NOTE -2128 Fajardo et al.Ciência Rural, v.42, n.12, dez, 2012.in the field. Nowadays the incidence of this complex isrecognized to have a strong economical impact worldwideon the grape industry (ROSA et al., 2011). Virusesassociated with the RW complex are Grapevine virus A(GVA), Grapevine virus B (GVB) and Grapevine rupestrisstem pitting-associated virus (GRSPaV) (DU-PREEZ etal., 2011). Another virus, Grapevine virus D (GVD) wasdetected in grapevine showing corky rugose woodsymptoms, but its role in the RW complex is still unclear(ABOU-GHANEM et al., 1997). Taxonomically, GVA, GVB,and GVD belong to genus Vitivirus and GRSPaV toFoveavirus, both in the family Betaflexiviridae. Theviruses associated with RW are usually transmitted in thevineyards via grafting and propagation of infected material(DU-PREEZ et al., 2011). GVA, GVB and GRSPaV havebeen reported in Brazil previously (LIMA, 2009). GVD isthe less studied virus in the RW complex and few GVDsequences are available in databases. ROSA et al. (2011)showed that GVD induced severe growth reduction in cv.‘Freedom’ rootstock with no symptoms on the woodycylinder of the plants.Grapevine leafroll-associated viruses(GLRaVs) are a group of viruses that collectively orindividually cause leafroll disease in grapevine. To date,eleven different viruses are associated with thegrapevine leafroll disease. The disease is of economicalimportance and limits the production of grapesthroughout the world. V. vinifera foliar symptoms area downward curling of the fully expanding leaves anda yellowing (in white cultivars) or reddening (in redcvs.) that intensifies at the end of the growing season.Berries tend to mature more slowly and irregularlyresulting in a lower yield and reduced total solublesugars, decreasing juice quality for wine and fruit juices(THOMPSON et al., 2012). The family Closteroviridaecontains all GLRaVs, including GLRaV-5 (Ampelovirus)and -6 (tentative member in the genus Ampelovirus)(ABOU GHANEM-SABANADZOVIC et al., 2012).Recently, the complete genomes of GLRaV-5(THOMPSON et al., 2012) and GLRaV-6 (ABOUGHANEM-SABANADZOVIC et al., 2012) weresequenced, revealing 13,384 and 13,807nt long,respectively. In Brazil, leafroll is one of the mostimportant viral diseases of grapevine. So far, GLRaV-5and -6 were serologically detected in leafroll diseasedgrapevines in Brazil (KUNIYUKI et al., 2003; KUNIYUKIet al., 2008). The objective of this work was to performthe partial molecular characterization of Brazilianisolates of GFkV, GVD, GLRaV-5 and -6.Results presented were obtained fromsamples of cultivars commercially introduced in Brazil,of which a collection was maintained by Embrapa Uvae Vinho in a screenhouse. Grapevines selected for virusisolation were from the cv. ‘Rupestris’ du Lot bud-inoculated with cv. ‘Benefuji’ exhibiting mild clearingin the minor veins of leaves. The cvs. ‘Dolcetto’ and‘Garganega’ exhibited, respectively, reddening oryellowing of leaves, with the main veins remaininggreen, as well as curling down of leaf edges andcoriaceous leaves. The cv. ‘Cardinal’ exhibitedcoriaceous and dark red spotted leaves. Thesesymptoms could not be associated with a single virus,since these plants could be mixed infected by at leastone more virus.Total RNA extractions were performed usingadsorption of nucleic acids on silica particles(DUBIELA, 2012). DNA fragments of GFkV, GVD,GLRaV-5 and -6 were amplified by RT-PCR using primerpairs listed in the table 1. The RT-PCR conditions wereas reported previously (FAJARDO et al., 2004). Cloningand sequencing of the DNA amplified fragments wereperformed as described by DUBIELA (2012). Theamplified sequences were aligned using the  softwareClustalX 1.8. Comparisons with other viral sequencesavailable in the GenBank were performed using theBLASTn and BLASTp program (http://www.ncbi.nlm.nih.gov). The molecular weight (MW)of the four viral proteins (three CPs and one RNAbinding protein) were calculated using the softwareEXPASy (http://web.expasy.org/compute_pi/).Until the present date, the number ofavailable nucleotide sequences of these viruses isrestricted to 3 for GVD, 4 for GLRaV-6, 23 for GFkV and43 for GLRaV-5, thus additional sequence informationabout other isolates of these virus species is highlydesirable. A DNA fragment of 719bp (base pairs) wassuccessfully amplified by RT-PCR from isolate BFcontaining the complete nt sequence of the CP gene(ORF, Open reading frame) of GFkV, with 693 nt and230 deduced amino acids (daa) (Table 1), which showedthe highest identities of nt and daa with the MT48(SABANADZOVIC et al., 2001) and the Cl-1155 isolatesfrom Italy and Chile, respectively (Table 1), the onlyavailable at GenBank that allowed full alignment of theCP gene with BF isolate. The multiple alignment of theCP sequence of isolate BF with GFkV sequences fromGenBank (MT48 and Cl-1155 isolates) revealed onlytwo amino acid divergences (data not shown),suggesting there is a low variability among the analyzedGFkV isolates. The calculated MW of the GFkV BFisolate CP of 24.31kDa was similar to that reported bySABANADZOVIC et al. (2001).The amplified GVD DNA fragment of 852bpcontains two complete gene sequences (ORFs) fromtwo GVD isolates named Dolc and Garg (Table 1): theCP gene with 486nt and 161daa (ORF4) and the RNA2129Detection and partial molecular characterization of Grapevine fleck virus, Grapevine virus D...Ciência Rural, v.42, n.12, dez, 2012.binding protein (RNA-BP) gene with 276nt and 91daa(ORF5). Since the RNA-BP gene, encoded by ORF5 ofVitivirus, has gene silencing suppressor functions andof pathogenicity determinant in GVA (DU-PREEZ et al.,2011), it may be assumed to have the similar functionsin GVD. The calculated MW of the CP (17.65kDa) andRNA-BP (10.34kDa) of isolate Dolc of GVD were verysimilar to a previous report (DU-PREEZ et al., 2011).The nt and daa sequences of Dolc and GargGVD isolates showed high identity (over ca. 90%) withthe Italian isolate (ABOU-GHANEM et al., 1997), theonly GVD isolate completely sequenced for the CP andRNA-BP genes (Table 1). The high identity among thethree GVD isolates (Dolc, Garg and Italian isolate) wasconfirmed by the multiple alignment of the daasequences, considering both CP (eight divergences)and RNA-BP (7-8 divergences) of the sequenced genes(data not shown), suggesting a low variability amongthe analyzed GVD isolates.Fragments of GLRaV-5, amplified fromextracts of cv. ‘Cardinal’, contain the complete sequenceof the CP gene with 798nt and 265daa and the partialhHSP70 gene with 565nt and 188daa (Table 1). Thecalculated MW of the Card5 isolate CP of 28.95kDawas similar to a previous report of THOMPSON et al.(2012). The nt and daa sequences of Card5 CP andTable 1 - Sequences of primers tested in the RT-PCR detection and pairwise percent identities of nucleotide and deduced amino acidsequences among Brazilian and foreign grapevine virus isolates.Virus(isolate) Primer sequence (5'-3')Brazilian GenBanknucleotide  accessionForeign isolate/ Origin% nucleotideidentity% deducedamino acididentityForeignGenBanknucleotideaccessionCCCTCTCCGCCTCGTCTG (v) JN022610 MT48, Italy96,1(CP)98,7(CP)NC_003347GFkV(BF)GCCTCGGTTCATGACGAG (c)Cl-1155,Chile93,9(CP)98,7(CP)HQ688989GACGCAGGGATGTACCTTAGGACG (v) JQ031715 (Dolc) Italy89,2(CP)95,0(CP)Y07764GVD(Dolc and  Garg)CCTCTACTTATGGAAATTGCGCTC (c) JQ031716 (Garg) Italy93,8(RNA-BP)92,3(RNA-BP)Y07764ATGTCTGGATCAGTGCAGGACG (v) JQ821315Colg. A2,Argentina98,1(CP)98,1(CP)HQ828110GLRaV-5(Card5)TCACCTCCTGTTACCCAAGAAG (c) Y217, France95,0(CP)96,3(CP)NC_016081AACACTCTGCTTTTCTGCTGGC (v) JQ821314 Y217, France96,0(hHSP70)100,0(hHSP70)NC_016081GLRaV-5(Card5)RTCIAAIGTICCICCICCRAA (c) USA95,2(hHSP70)100,0(hHSP70)AF233934GGITTIGAITTYGGIACIAC (v) JQ290111 Estellat, USA97,4(hHSP70)97,0(hHSP70)NC_016417GLRaV-6(Card)RTCIAAIGTICCICCICCRAA (c)- GFkV, GVD and GLRaV-5 (CP) primers designed in this work, GLRaV-5 (hHSP70) and GLRaV-6 primers cited by DUBIELA et al.(2012); (v) forward, (c) reverse; I (inosine); CP (coat protein), RNA-BP (RNA binding protein) and hHSP70 (homologous heat shock protein70); the comparisons include only foreign isolates whose available gene sequences were complete.2130 Fajardo et al.Ciência Rural, v.42, n.12, dez, 2012.partial hHSP70 genes showed high identities (morethan 96%) with the Argentinean (Colgadera A2) andFrench (Y217) isolates, respectively (Table 1). In themultiple alignment of daa sequences of the Card5 isolateand the Argentinean (CP) or French (hHSP70) GLRaV-5 isolates, there were five  divergences in the CP codingregion, whereas no divergences were found for thehHSP70 protein partial coding region (data not shown),suggesting limited variability among the GLRaV-5analized isolates.The GLRaV-6 Card isolate from cv. ‘Cardinal’was amplified by RT-PCR resulting in a DNA fragmentof expected size. This fragment contains the partialsequence of the hHSP70 gene with 591nt and 197daa(Table 1). The Card isolate sequences showed thehighest nt and daa identities with the GLRaV-6 Estellatisolate (Table 1), characterized by ABOU GHANEM-SABANADZOVIC et al. (2012). In the alignment of daasequences, there were six divergences between thesetwo isolates (data not shown), indicating restrictedvariability among the GLRaV-6 analized isolates. Virusesassociated with leafroll disease are frequently found inmixed infection, therefore extended informations aboutnucleotide sequences of more isolates is relevant toovercome the inherent difficulties of  moleculardetection and characterization of these viruses.This work constitutes the firstcharacterization of the complete CP gene of a GFkVisolate from Brazil, the first report of GVD sampled ingrapevines in Brazil and the first molecularcharacterizations of the GLRaV-5 and GLRaV-6 isolatesfrom grapevines in Brazil. These results expand ourknowledge on the variability of these viruses. Theseresults provide relevant information for thedevelopment of improved detection and controlstrategies in the frame of programs for production ofhealthy grapevine material.REFERENCESABOU GHANEM-SABANADZOVIC, N. et al.  Genomeorganization, serology and phylogeny of Grapevine leafroll-associated viruses 4 and 6: taxonomic implications.  VirusResearch, v.163, p.120-128, 2012. Available from: <http://dx.doi.org/10.1016/j.virusres.2011.09.001>. Accessed: sep. 03,2012. doi: 10.1016/j.virusres.2011.09.001.ABOU-GHANEM, N. et al.  Properties of Grapevine virus D, anovel putative trichovirus.  Journal of Plant Pathology,v.78, p.15-25, 1997.DUBIELA, C.R.  Detecção por RT-PCR em tempo real(Taqman) e caracterização molecular parcial de vírusque infectam a videira. 2012.  127f.  Dissertação (Mestradoem Genética e Melhoramento) - Universidade Estadual deMaringá, PR.DU-PREEZ, J. et al.  The grapevine infecting vitiviruses, withparticular reference to Grapevine virus A.  Archives ofVirology, v.156, p.1495-1503, 2011. Available from: <http://dx.doi.org/10.1007/s00705-011-1071-3>. Accessed: sep. 03,2012. doi: 10.1007/s00705-011-1071-3.FAJARDO, T.V.M. et al.  Detecção e caracterização molecularparcial do Grapevine fleck virus em videiras.  FitopatologiaBrasileira, v.29, p.460, 2004. Available from: <http://dx.doi.org/10.1590/S0100-41582004000400020>. Accessed:sep. 03, 2012.  doi: 10.1590/S0100-41582004000400020.KUNIYUKI, H. et al.  Ocorrência do Grapevine leafroll-associated virus 6  em vinhedos do Brasil.  SummaPhytopathologica, v.29, p.288-289, 2003.KUNIYUKI, H. et al.  Detecção do Grapevine leafroll-associated virus 5 no Estado de São Paulo.  SummaPhytopathologica, v.34, p.366-367, 2008. Available from:<http://dx.doi.org.ez103.periodicos.capes.gov.br/10.1590/S0100-54052008000400014>. Accessed: sep. 03, 2012.  doi:10.1590/S0100-54052008000400014.LIMA, M.F.  Detecção e controle de viroses em videira .Petrolina: Embrapa Semiárido, 2009.  9p.  Disponível em:<http://www.cpatsa.embrapa.br:8080/public_eletronica/downloads/CTE90.pdf>.  Acesso em: 02 ago. 2012.MARTELLI, G.P.  Grapevine virology highlights 2006-09.  In:MEETING OF INTERNATIONAL COUNCIL OF VIRUSESAND VIRUS DISEASES OF GRAPEVINE, 16., 2009, Dijon,France.  Extended abstracts...  Dijon:ICVG, 2009.  p.15-23.ROSA, C. et al.  Symptomatology and effects of virusesassociated with rugose wood complex on the growth of fourdifferent rootstocks.  American Journal of Enology andViticulture, v.62, p.207-213, 2011. Available from: <http://dx.doi.org/10.5344/ajev.2011.10104>. Accessed: sep. 03, 2012.doi: 10.5344/ajev.2011.10104.SABANADZOVIC, S. et al.  Complete nucleotide sequence andgenome organization of Grapevine fleck virus.  Journal ofGeneral Virology, v.82, p.2009-2015, 2001. Available from:<http://vir.sgmjournals.org.ez103.periodicos.capes.gov.br/content/82/8/2009.full.pdf+html>. Accessed: sep. 03, 2012.THOMPSON, J.R. et al.  Genomic analysis of Grapevine leafrollassociated virus 5 and related viruses.  Virus Research, v.163,p.19-27, 2012. Available from: <http://dx.doi.org/10.1016/j.virusres.2011.08.006>. Accessed: sep. 03, 2012. doi: 10.1016/j.virusres.2011.08.006.

Detection and partial molecular characterization of Grapevine fleck virus, Grapevine virus D, Grapevine leafroll-associated virus -5 and -6 infecting grapevines in Brazil.

http://www.alice.cnptia.embrapa.br/alice/bitstream/doc/941752/1/FAJARDOCiRuralv42n12p21272012.pdf

Detection and partial molecular characterization of Grapevine fleck virus, Grapevine virus D, Grapevine leafroll-associated virus -5 and -6 infecting grapevines in Brazil.

Abstract

Similar works

Full text

Available Versions

Repository Open Access to Scientific Information from Embrapa