Schematic illustration of analysis of quadruplex stabilization by exonuclease I hydrolysis

<p><b>Copyright information:</b></p><p>Taken from "An exonuclease I hydrolysis assay for evaluating G-quadruplex stabilization by small molecules"</p><p></p><p>Nucleic Acids Research 2007;35(9):e68-e68.</p><p>Published online 10 Apr 2007</p><p>PMCID:PMC1888815.</p><p>© 2007 The Author(s)</p> () G-quadruplex-dependent inhibition of hydrolysis by exonuclease I. The assay uses a quadruplex-forming and non-quadruplex-forming oligomer (QFO and NQFO) labeled with P at the 5′ end. The quadruplex at the 3′ end of the QFO cannot be processed by exonuclease I until it becomes unfolded. The hydrolysis does not proceed to the very end producing a short fragment of ∼8–9 nt which is separated from the input oligonucleotide by gel electrophoresis based on their size and visualized by radioautography. () Information provided by the exonuclease I hydrolysis assay. The assay generates hydrolysis curve for the two oligomers and clarifies inhibition from different sources: , structure-dependent inhibition by salt in the medium; , structure-dependent inhibition by compound; , structure-dependent inhibition by salt and compound; , non-specific inhibition by compound at high concentration via interaction with DNA or/and protein. Green bar indicates the concentration range within which the compound stabilizes quadruplex without affecting single-stranded substrate; red bar indicates the concentration range within which the compound affects hydrolysis of single-stranded substrate

Quadruplex formation by T24G21 and its resistance to hydrolysis by exonuclease I

<p><b>Copyright information:</b></p><p>Taken from "An exonuclease I hydrolysis assay for evaluating G-quadruplex stabilization by small molecules"</p><p></p><p>Nucleic Acids Research 2007;35(9):e68-e68.</p><p>Published online 10 Apr 2007</p><p>PMCID:PMC1888815.</p><p>© 2007 The Author(s)</p> () Native gel (19%) electrophoresis showing quadruplex formation by T24G21 in 150 mM K. () Quadruplex formation by (GTA)G as a function of K concentration examined by fluorescence resonance energy transfer (FRET). () Hydrolysis of T24RG21 (open circles) and T24G21 (filled circles) by exonuclease I as a function of K concentration. (Left) Separation of input oligonucleotide and hydrolysis product (P) by gel electrophoresis. Lane 1: no exonuclease, lanes 2–9: treated with 0.04 U exonuclease I for 20 min in buffer containing increasing concentrations of K. LiCl was added to make the total concentration of monovalent cation to 150 mM. (Right) Quantification of oligonucleotide hydrolysis. Data represent the mean of three experiments with standard deviation

Effect of () TMPyP4, () BMVC and () DODC on the hydrolysis of the gene sequence T24c-myc22 (TGAGGGTGGGGAGGGTGGGGAAG, filled circles) and T24RG21 (open circles) by exonuclease I

<p><b>Copyright information:</b></p><p>Taken from "An exonuclease I hydrolysis assay for evaluating G-quadruplex stabilization by small molecules"</p><p></p><p>Nucleic Acids Research 2007;35(9):e68-e68.</p><p>Published online 10 Apr 2007</p><p>PMCID:PMC1888815.</p><p>© 2007 The Author(s)</p> Assays were carried out in buffer containing 2.5 mM KCl, 147.5 mM LiCl and the indicated compound at various concentrations. Results represent the mean of two hydrolysis experiments with range

New adaptive control strategies for open-end winding permanent magnet synchronous generator(OEW-PMSG) for wind power generation

A wind turbine system with an new open-end-winding permanent magnet synchronous generator (OEW-PMSG) is studied in this paper, with a focus on torque ripple minimisation of the OEW-PMSG. The problem of torque ripple minimisation of OEW-PMSGs is addressed. Generally, the q-axis current injection method is employed to suppress the torque ripple. However, the third flux linkage parameters will be affected by high temperature when the machine is operating. In order to solve this problem, two sensorless adaptive control methods are presented in the following paper. The first method is based on adaptive sliding mode control and deadbeat-based predictive current control. The second method is based on model reference adaptive control with deadbeat predictive control. In these two control systems, a zero-sequence back-EMF observer (ZCBO) is used to estimate the zero-sequence back-EMF and zero-sequence current simultaneously and continuously. Meanwhile, the zero-sequence voltage which exists in the zero-sequence path and interferes the ZCBO's performance is considered. The performance of two control strategies is evaluated in MATLAB/SIMULINK environment

Real-Time Detection Reveals Responsive Cotranscriptional Formation of Persistent Intramolecular DNA and Intermolecular DNA:RNA Hybrid G‑Quadruplexes Stabilized by R‑Loop

G-quadruplex (GQ) structures are implicated in important physiological and pathological processes. Millions of GQ-forming motifs are enriched near transcription start sites (TSSs) of animal genes. Transcription can induce the formation of GQs, which in turn regulate transcription. The kinetics of the formation and persistence of GQs in transcription is crucial for the role they play but has not yet been explored. We established a method based on the fluorescence resonance energy transfer (FRET) technique to monitor in real-time the cotranscriptional formation and post-transcriptional persistence of GQs in DNA. Using a T7 transcription model, we demonstrate that a representative intramolecular DNA GQ and DNA:RNA hybrid GQ promptly form in proportion to transcription activity and, once formed, are maintained for hours or longer at physiological temperature even after transcription is stopped. Both their formation and persistence strongly depend on R-loop, a DNA:RNA hybrid duplex formed during transcription. Enzymatic removal of R-loop dramatically slows their formation and accelerates their unfolding. These results suggest that a transcription event is promptly read-out by GQ-forming motifs and the GQ formed can either perform regulation in fast response to transcription and/or memorized in DNA to mediate time-delayed regulation under the control of RNA metabolism and GQ-resolving activity. Alternatively, GQs need to be timely resolved to warrant success of translocating activities such as replication. The kinetic characteristics of GQs and its connection with the R-loop may have implications in transcription regulation, signal transduction, G-quadruplex processing, and genome stability

Transition-Metal-Free Trifluoromethylation of Aldehyde Derivatives with Sodium Trifluoromethanesulfinate

A metal-free and cost-effective synthetic protocol for the trifluoromethylation of <i>N</i>,<i>N</i>-disubstituted hydrazones with Langlois’s reagent (CF₃SO₂Na) to afford the corresponding functionalized trifluoromethyl ketone hydrazones has been established. It is proposed that a radical/SET mechanism proceeding via a trifluoroalkyl radical may be involved in the reaction. Applications of the methodology in industry will be found and the development of new methods for trifluoromethylation with Langlois’s reagent will be continued in our laboratory

Superhelicity Constrains a Localized and R‑Loop-Dependent Formation of G‑Quadruplexes at the Upstream Region of Transcription

Transcription induces formation of intramolecular G-quadruplex structures at the upstream region of a DNA duplex by an upward transmission of negative supercoiling through the DNA. Currently the regulation of such G-quadruplex formation remains unclear. Using plasmid as a model, we demonstrate that while it is the dynamic negative supercoiling generated by a moving RNA polymerase that triggers a formation of a G-quadruplex, the constitutional superhelicity determines the potential and range of the formation of a G-quadruplex by constraining the propagation of the negative supercoiling. G-quadruplex formation is maximal in negatively supercoiled and nearly abolished in relaxed plasmids while being moderate in nicked and linear ones. The formation of a G-quadruplex strongly correlates with the presence of an R-loop. Preventing R-loop formation virtually abolished G-quadruplex formation even in the negatively supercoiled plasmid. Enzymatic action and protein binding that manipulate supercoiling or its propagation all impact the formation of G-quadruplexes. Because chromosomes and plasmids in cells in their natural form are maintained in a supercoiled state, our findings reveal a physical basis that justifies the formation and regulation of G-quadruplexes <i>in vivo</i>. The structural features involved in G-quadruplex formation may all serve as potential targets in clinical and therapeutic applications

Flt3L combined with Rapa promotes the production of CD4⁺CD25⁺Foxp3⁺ and CD8⁺CD25⁺Foxp3⁺ T cells.

<p>Spleen cells isolated from mice treated with Flt3L/Rapa and other control mice at the time of rejection or at study endpoint (POD 100) were analyzed to determine the proportion of CD4⁺ CD25⁺ Foxp3⁺ and CD8⁺ CD25⁺ Foxp3⁺ T cells. (A, B) The expression of Foxp3 by CD4⁺ CD25⁺ and CD8⁺ CD25⁺ T cells was analyzed by flow cytometry after intracellular staining. The bar graph was a summary of percentages of CD4⁺ CD25⁺ Foxp3⁺ T cells and CD8⁺ CD25⁺ Foxp3⁺ T cells in the recipients. The data shown are representative of three independent experiments that yielded comparable results (* <i>P</i><0.05).</p

Flt3L/Rapa therapy favors anergic induction in alloreactive T cells.

<p>(A) Splenic T cells originated from cardiac allograft recipient mice at the time of rejection or at study endpoint (POD 100) were used as responder cells for MLR assay with donor-derived DCs (DC: T ratio of 1∶5). Bar graph was the summary of proliferation index (PI) of T cells isolated from different recipients. (B) The culture supernatants were harvested and cytokine IL-10 levels were quantification by ELISA. The data shown are representative of three independent experiments (*<i>P</i><0.05).</p

CD8⁺ T cells and pDCs play a dominant role to promote allograft long-term survival.

<p>The purified CD4⁺ T cells (5×10⁶), CD8⁺ T cells (5×10⁶), pDCs (5×10⁵) and total splenotytes (5×10⁶) originated from recipients with long-term allograft survival were then adoptively transferred into naive recipients respectively. One day after the adoptive transfer, the mice were transplanted with cardiac allograft. The survival time of cardiac allografts was monitored. The data shown are representative of three independent experiments (*P<0.05).</p