Is elevated SUA associated with a worse outcome in young Chinese patients with acute cerebral ischemic stroke?

<p>Abstract</p> <p>Background</p> <p>Elevated serum uric acid (SUA) levels can enhance its antioxidant prosperities and reduce the occurrence of cerebral infarction. Significantly elevated SUA levels have been associated with a better prognosis in patients with cerebral infarction; however, the results from some studies on the relationship between SUA and the prognosis of patients with cerebral infarction remain controversial.</p> <p>Methods</p> <p>We analyzed the relationship between SUA and clinical prognosis of 585 young Chinese adults with acute ischemic stroke as determined by the modified Rankin Scale at discharge. Using multivariate logistic regression modeling, we explore the relationship between SUA levels and patient's clinical prognosis.</p> <p>Results</p> <p>Lower SUA levels at time of admission were observed more frequently in the lowest quintile for patients with severe stroke (P = 0.02). Patients with cerebral infarction patients caused by small-vessel blockage had higher SUA concentrations (P = 0.01) and the lower mRS scores (P < 0.01) were observed in, while the lowest SUA concentrations and the highest mRS scores were seen in patients with cardiogenic cerebral infarction patients. Logistic regression analysis adjusted for confounders confirmed the following independent predictors for young cerebral infarction: uric acid (-0.003: 95%CI 0.994 to 0.999) and platelet (0.004, 95%CI 0.993 to 0.996).</p> <p>Conclusion</p> <p>Elevated SUA is an independent predictor for good clinical outcome of acute cerebral infarction among young adults.</p

Halpe sikkima Moore 1882

&lt;i&gt;Halpe sikkima&lt;/i&gt; Moore, 1882 (Fig. 1) &lt;p&gt; &lt;i&gt;Halpe sikkima&lt;/i&gt; Moore, 1882: 407, TL: Sikkim; Elwes &amp; M&ouml;ller, 1888: 453; Evans, 1949: 260; Eliot, 1992: 350; Osada et al., 1999: 192; Yuan et al., 2007: 310; Ek-Amnuay, 2012: 828; Yuan et al., 2015: 397; Monastyrskii &amp; Devyatkin, 2016: 77.&lt;/p&gt; &lt;p&gt; &lt;i&gt;Halpe selangora&lt;/i&gt; Swinhoe, 1913: 283, TL: Selangor, Malaya. Synonymised by Evans, 1949.&lt;/p&gt; &lt;p&gt; &lt;b&gt;Distribution.&lt;/b&gt; Sikkim to Indochina, Hainan, Malay Peninsula, Borneo, Sumatra, Java.&lt;/p&gt; &lt;p&gt; &lt;b&gt;Material examined.&lt;/b&gt; 1 &lt;i&gt;3&lt;/i&gt;, Wuzhishan, Hainan, China, 15.IV.2015, G.X. Xue leg.&lt;/p&gt; &lt;p&gt; &lt;b&gt;Male genitalia&lt;/b&gt; (Fig. 2). In dorsal view, tegumen slightly tapered; uncus basally constricted and distally expanded, its end deeply bifid into a pair of inwardly curved blunt-pointed horns. Lateral processes reach to half of the horns of uncus, ventral side with a small hook in the middle, distal half thinner and tapered. Gnathos distally tapered and left and right parts separated from each other. Saccus short. Dorsal margin of valva slightly bifid in the middle, basal half flat, without footstalk; distal half densely furnished with strong sawteeth, dorsal margin widely U-shaped, forming a triangular basal branch and a narrower elongated distal branch, of which the distal margin is shallowly indented to form a strong upper branch and a small lower branch. Aedeagus shorter than ventral margin of valva, suprazonal sheath tapered toward fore-end, dorsal margin of subzonal sheath deeply concave. Juxta quadrangular.&lt;/p&gt; &lt;p&gt; &lt;b&gt;COI sequence.&lt;/b&gt; Genbank Accession MH444659, voucher HaiN-A32, 661 base pairs: ATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCT CTAAGATTATTAATTCGTACTGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTAT TGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACT AGTTCCCCTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGAATGTTACCCC CTTCTTTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGTACCGGATGAACAGTTTACCCCC CTCTTTCTTCTAATATTGCTCATCAAGGTTCATCCGTTGATTTAGCTATTTTTTCCTTACATTTAGCAGGTATTT CCTCAATTTTAGGGGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAA TACCTTTATTCGTTTGAGCTGTAGGAATTACTGCTTTACTTTTATTACTTTCATTACCAGTTTTAGCTGGAGCT ATTACAATATTATTAACTGATCGAAATTTAAATACtTCTTTTTTTGATCCTGCAGGAGGAGGAGATCC&lt;/p&gt; &lt;p&gt; &lt;b&gt;Remarks.&lt;/b&gt; Evans (1949) recorded one male &lt;i&gt;Halpe sikkima&lt;/i&gt; from Hainan. Since then, no more material of this species has been collected from this place again, although field surveys have been carried out on the island repeatedly, and a number of hesperiid species have been published as new to science (Chou 1994; Fan &lt;i&gt;et al&lt;/i&gt;. 2007a; Fan &lt;i&gt;et al&lt;/i&gt;. 2007b; Fan &amp; Chiba 2008) or discovered as new records to the skipper fauna of China (Fan &lt;i&gt;et al&lt;/i&gt;. 2003; Fei &lt;i&gt;et al&lt;/i&gt;. 2015). In recent literature specializing in the fauna of Hainan skippers (e.g. Gu &amp; Chen 1997; Gu 2002; Chiba 2008), this species was not included. Thus, &lt;i&gt;H. sikkima&lt;/i&gt; remained a mysterious species in Hainan, and its occurrence on the island needed reconfirmation. During a collecting trip at Wuzhishan (Fig. 3) in 2015, a male &lt;i&gt;H. sikkima&lt;/i&gt; was captured by the first author of the present paper, representing the second specimen of this species from the island. Considering the figures and descriptions of the male genitalia in literature which are not complete and precise enough (Evans 1949; Maruyama 1991), illustrations and a re-description are provided in this paper. DNA was extracted from one leg of the dried specimen using DNeasy &lt;i&gt;&reg;&lt;/i&gt; Blood and Tissue Kit (Qiagen, Germany). The COI gene was amplified by PCR as described by Hajibabaei &lt;i&gt;et al.&lt;/i&gt; (2006) and then sequenced by Sangon biotech, Shanghai, China. The COI sequence is published herein for the potential use in DNA barcoding and a molecular phylogeny study in the future.&lt;/p&gt;Published as part of &lt;i&gt;Xue, Guoxi, Lv, Hongkun, Hu, Neng, Yin, Weizhi &amp; Li, Meng, 2018, Rediscovery of an elusive species, Halpe sikkima Moore, 1882 (Hesperiidae, Hesperiinae) from Hainan, China, pp. 85-88 in Zootaxa 4486 (1)&lt;/i&gt; on pages 85-86, DOI: 10.11646/zootaxa.4486.1.7, &lt;a href="http://zenodo.org/record/1438057"&gt;http://zenodo.org/record/1438057&lt;/a&gt

Robust and Lightweight Data Aggregation with Histogram Estimation in Edge-Cloud Systems

Secure aggregation based on masked encryption is a crucial technique for data collection in the Internet of Things (IoT) as it employs a lightweight style to enable global data aggregation while protecting individual data. However, network instability makes the design of such schemes more complex as dropout-resiliency is required, where the overheads substantially increase with growing dropped users. Moreover, existing methods primarily concentrate on aggregation and fail to support complex data analysis, such as histogram estimation. This paper proposes a Robust and Lightweight Data Aggregation (RLDA) scheme in edge-cloud systems. RLDA leverages the offline/online paradigm to achieve robust data aggregation, where edge nodes are introduced to assist verifiable key generation offline and data aggregation and key recovery online. RLDA decouples keys of dropped and surviving users so that it can reduce the overhead by always recovering the keys of surviving users rather than reconstructing the keys of growing dropped users. To achieve secure histogram estimation, we design two recoverable aggregation algorithms that support the transformation between vector and single value, and additionally support multidimensional data aggregation. We prove the security and dropout-resiliency of RLDA. The performance shows that RLDA significantly reduces the overhead with growing dropped users

Rediscovery of an elusive species, Halpe sikkima Moore, 1882 (Hesperiidae, Hesperiinae) from Hainan, China

Xue, Guoxi, Lv, Hongkun, Hu, Neng, Yin, Weizhi, Li, Meng (2018): Rediscovery of an elusive species, Halpe sikkima Moore, 1882 (Hesperiidae, Hesperiinae) from Hainan, China. Zootaxa 4486 (1): 85-88, DOI: https://doi.org/10.11646/zootaxa.4486.1.

High-Performance Motion Estimation for Image Sensors with Video Compression

It is important to reduce the time cost of video compression for image sensors in video sensor network. Motion estimation (ME) is the most time-consuming part in video compression. Previous work on ME exploited intra-frame data reuse in a reference frame to improve the time efficiency but neglected inter-frame data reuse. We propose a novel inter-frame data reuse scheme which can exploit both intra-frame and inter-frame data reuse for ME in video compression (VC-ME). Pixels of reconstructed frames are kept on-chip until they are used by the next current frame to avoid off-chip memory access. On-chip buffers with smart schedules of data access are designed to perform the new data reuse scheme. Three levels of the proposed inter-frame data reuse scheme are presented and analyzed. They give different choices with tradeoff between off-chip bandwidth requirement and on-chip memory size. All three levels have better data reuse efficiency than their intra-frame counterparts, so off-chip memory traffic is reduced effectively. Comparing the new inter-frame data reuse scheme with the traditional intra-frame data reuse scheme, the memory traffic can be reduced by 50% for VC-ME

An Investigation of Physical and Mental Health Consequences among Chinese Parents who Lost their Only Child

Background: The term “loss-of-only-child family” means that the only child in a family passed away or is disabled due to an accident or other events. The parents who cannot conceive or do not adopt another child, are known as Shidu parents in China. This study compares the physical and mental health of Shidu parents with those parents who have not experienced such loss. Methods: The target group is comprised of parents being Shidu for more than 1 year (N = 95) and the control group is comprised of parents with a living child (N = 97) from the same area as the Shidu parents. Socio-demographic information and physical health outcomes were collected by the adapted questionnaires. PCL-C (PTSD Checklist-Civilian Version), CES-D (Center for Epidemiological Studies Depression Scale) and GHQ-12 (General Health Questionnaire) were applied to evaluate the parents’ physical and mental status. Results: Shidu parents have a higher risk of developing PTSD and depression, and suffer more severe psychiatric disorders compared to parents with a living child. The rate of PTSD in the Shidu group was up to 32.6% and the scores of PCL-C are much higher than the control group. The physical status of Shidu parents were much worse than that of the control group, characterized by higher morbidity of chronic diseases and more hospital visits. Conclusions: Shidu parents have more severe mental health problems and a higher rate of chronic diseases than parents who have a living child. Loss of the only child is the most traumatic event for the parents, which is a serious and unique problem in Chinese society that deserves attention. More studies and support are desired to improve the physical and mental health of Shidu parents