Incorporating toxicology in the synthesis of industrial chemical complexes

Technical Repor

Effects of VEGFR1 and VEGFR2 blockade in mice with DIO.

<p><i>A:</i> Body weight gain relative to weight at day 0 for mice given different diets and treatments. Male C57BL6 mice, 10–12 weeks old at time 0, were used for all groups. All diets and treatments began at day 0, at dosages and schedules as described in the <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0004974#s2" target="_blank">Methods</a> section. DC101+HFD: high fat diet, DC101 treatment, white triangles. MF1+HFD: high fat diet, MF1 treatment, black squares. HFD: high fat diet controls, no treatment (n = 4) or PBS treatment (n = 4), white circles. LFD: standard diet controls, crosses. <i>B:</i> Average cross-sectional area (µm²) of adipocytes in the perigonadal fat pad at various times after beginning of high fat diet. 3–4 mice at each time point, >300 adipocytes measured for each mouse. Adipocytes in the inguinal fat pad showed a similar trend (not shown). <i>C:</i> Food intake (g/day/kg body weight) in the DC101+HFD versus HFD groups, when the DC101+HFD group was gaining less weight (days 43–91). D: Reversibility of the effects of DC101. DC101 treatment was discontinued from day 91 onward. About two weeks after cessation of treatment, the rate of weight gain in the previously treated animals resumed at a higher rate, and their body weights eventually caught up with untreated controls. All data reported as mean±sem. Asterisks denote significant difference between DC101+HFD and HFD groups (P<0.05).</p

Imaging of adipose tissue vasculature in GFP transgenic mice.

<p><i>A</i>: Incorporation of BMD-EC in mammary fat pad vasculature in WT/Tie2-GFP-BMT mice. <i>B</i>: <i>Ex vivo</i> confocal microscopy imaging of mammary fat pad in two mice with age-related obesity (∼18 months old). BMD-EC contributed to approximately 8% of the mammary fat pad vasculature. <i>C</i>: Representative image of GFP+ BMD-EC in the mammary fat pad of an obese mouse after 6 weeks on a high fat diet. BMD-EC contribution to mammary fat pad vasculature was minimal (0.8%, n = 4). Vessels were perfused with biotinylated-lectin and stained with streptavidin Texas Red (shown in red), while the nuclei were stained with DAPI (in blue, <i>A</i>, <i>B</i>). Rhodamine-dextran MW 2,000,000 was infused for vessel enhancement in <i>C</i>. <i>D:</i> Representative image of occasional GFP+ BMD-EC (arrow) in perfused mammary fat pad blood vessels in a 12 months old WT/Actb-GFP-BMT mouse. Vessels were perfused with biotinylated-lectin and stained with streptavidin Texas Red (red), while the nuclei were stained with DAPI (blue). Images are 1.72 mm across in <i>A</i>, 310 µm across in <i>B</i>, 700 µm across in <i>C</i>, 1.72 mm across in <i>D</i>.</p

DC101 increases host PDGF-C expression.

<p>U87MG tumor-bearing mice were treated with DC101 (40 mg/kg) when their tumors reached 2 mm in diameter. Tumors were harvested and snap-frozen at baseline (n = 9), 2 days (n = 8) and 8 days (n = 5) after initiation of treatment. Day 8 corresponds to the time of escape from DC101 treatment in this model<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0005123#pone.0005123-Winkler1" target="_blank">[24]</a>. Quantitative PCR was performed using primers for mouse PDGF-C (forward primer: ACCACGAGTCCTTCGGTGTT, located at 529 bp; reverse primer: GCATTGTTGAGCAGGTCCAA, located at 566 bp). At day 8 DC101-treated tumors had significantly more mouse PDGF-C compared to base line and to control, baseline tumors (p<0.05) IgG-treated animals die before day 8.</p

Blood vessel morphology in brain tumors.

<p>A: PDGF-C expression causes a decrease in vessel diameter over 15 days of growth. B: At day 15 after implantation, the vessel size distribution in the PDGF-C over-expressing tumors resembles that of normal brain, while the siRNA and parental tumors have distributions shifted to higher diameters, with significant numbers of large-diameter (>25 µm) vessels. C: representative 2-photon images of the vessel networks.</p

Presentation_1_Exercise intensity governs tumor control in mice with breast cancer.pdf

IntroductionExercise is recommended as an adjunct therapy in cancer, but its effectiveness varies. Our hypothesis is that the benefit depends on the exercise intensity.MethodsWe subjected mice to low intensity (Li), moderate intensity (Mi) or high intensity (Hi) exercise, or untrained control (Co) groups based on their individual maximal running capacity.ResultsWe found that exercise intensity played a critical role in tumor control. Only Mi exercise delayed tumor growth and reduced tumor burden, whereas Li or Hi exercise failed to exert similar antitumor effects. While both Li and Mi exercise normalized the tumor vasculature, only Mi exercise increased tumor infiltrated CD8+ T cells, that also displayed enhanced effector function (higher proliferation and expression of CD69, INFγ, GzmB). Moreover, exercise induced an intensity-dependent mobilization of CD8+ T cells into the bloodstream.ConclusionThese findings shed light on the intricate relationship between exercise intensity and cancer, with implications for personalized and optimal exercise prescriptions for tumor control.</p

PDGF-C affects the transvascular flux of BSA.

<p>A: Effective vascular permeability was measured 6 days and 15 days after tumor implantation. The vessels in PDGF-C overexpressing tumors have lower permeability both 6 and 15 days following implantation. Normal brain (NB) vessels are relatively impermeable. B: Delivery of the BSA marker (red) is inhibited by PDGF-C overexpression (Green = CD31).</p

Granuloma IFP estimates from the shell-core model.

Predicted dimensionless (A) IFP and (B) IFP profiles within granulomas for different moduli α0 and for the shell-core perfusion model, with ξD = 0.5. (TIFF)</p

PDGF-C attenuates the response to VEGFR2 blockade.

<p>U87MG or U87-C tumor-bearing mice were treated with DC101 antibody (40 mg/kg) when their tumors reached 2 mm in diameter. Intravenous injections of DC101 were performed on days 0, 3 and 6. Vessels in the parental U87MG tumors are pruned in response to DC101 (fewer branch points). In contrast, U87-C tumors showed no response (n = 6).</p

Changes in wall structure in response to PDGF-C overexpression.

<p>NG2 expression detected by confocal imaging of U87MG (A) and U87-C (B) tumors using immunohistochemistry on frozen sections of tumors harvested after 3 weeks post-implantation. Red pseudocolor represents NG2 positive cells, green pseudocolor represents CD31 positive endothelial cells. Panel C shows staining for NG2 (blue), desmin (red) and CD31 (green) on a 100 µm projection acquired with a confocal microscope. Panels D and E: quantification of NG2 and desmin, respectively. PDGF-C expression does not affect desmin-positive cell recruitment, but dramatically increases the number of NG2-positive cells around vessels. F: collagen IV distribution around vessels. The basement membrane is typically thicker than normal in U87MG <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0005123#pone.0005123-Winkler1" target="_blank">[24]</a> but U87-C displays an even thicker basement membrane.</p