Biophysical Studies on the Effect of the 13 Position Substitution of the Anticancer Alkaloid Berberine on Its DNA Binding

The structural effects and thermodynamics of the DNA binding of six berberine analogues with alkyl chains of varying length and a terminal phenyl group at the C-13 position were investigated. All the analogues bound DNA noncooperatively in contrast to the cooperative binding of berberine. The binding affinity was higher and the effect of the chain length was only up to (CH₂)₃, after which the binding affinity decreased slightly. Intercalative binding with strong stabilization of the DNA helix was revealed. Binding resulted in the weakening of the base stacking with moderate conformational changes within the B-form. The binding was entropy driven in each case, the entropy contribution to the free energy increasing with the chain length up to the threshold (CH₂)₃. The complexation was dominated by nonpolyelectrolytic forces in each case; polyelectrolytic forces contributed only a quarter to the total free energy at 50 mM [Na⁺]. Overall, the phenylalkyl substitution at the C-13 position considerably enhanced the DNA binding and was highest for the analogue with (CH₂)₃. Structural and thermodynamic data on the DNA binding aspects of the substituted berberines are presented in comparison with berberine

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

<p>Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M⁻¹], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M⁻¹, and that of BER was (0.98 ± 0.03) × 10⁵ M⁻¹. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.</p