Comparison of the diversity of the human TCRb repertoire and the sensitivity of various methods for repertoire analysis.

<div><p> <b>(A)</b> The human T-cell repertoire contains an estimated 10⁶ rearrangements per individual (<i><a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone.0000055-Arstila1" target="_blank">ref. 2</a></i>).</p> <p> <b>(B)</b> The sensitivity of Vβ/Cβ immunoscope is approximately 2 in 10⁴ (<i><a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone.0000055-Hohlfeld1" target="_blank">ref. 15</a> and </i><a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone-0000055-g003" target="_blank"><i>Fig. 3A</i></a>).</p> <p> <b>(C)</b> Based on the number of Jβ primers, it is estimated that Vβ/Jβ immunoscope is 12-fold more sensitive than Vβ-Cβ immunoscope.</p> <p> <b>(D,E)</b> The sensitivity by which TCR rearrangements are picked by indivual cloning, depends on the number of clones sequenced (<i><a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone.0000055-Betts1" target="_blank">ref. 5</a>–<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone.0000055-Rohrlich1" target="_blank">9</a></i>).</p> <p> <b>(F)</b> The sensitivity of the T-array is approximately 1 in 10⁶ rearrangements (<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone-0000055-g003" target="_blank"><i>Fig. 3C</i></a>).</p></div

Spectratyping and T-array for Jurkat T-cell clone mixed with peripheral blood CD4⁺ T-cells.

<div><p>Jurkat cells were added in different dilutions to a background of peripheral blood CD4⁺ T-cells.</p> <p> <b>(panel A)</b> CDR3 spectratyping with Vβ12-specific primer.</p> <p>The arrow indicates a length identical to 14 amino acids, which is the length of the Jurkat CDR3β.</p> <p> <b>(panel B)</b> A detail of the T-array scans.</p> <p>White arrows indicate hexamer sequence GTTCGG, which is complementary to the first six nucleotides Jurkat NDNβ region.</p> <p> <b>(panel C)</b> Signal intensities of all 4096 spots of the T-array.</p> <p>Black arrows indicate hexamer sequence GTTCGG.</p></div

The T-array protocol.

<div><p> <b>(A)</b> During development, VDJ recombination causes enormous variability in TCRβ chain by randomly selecting different combinations of 23 V, 2 D, and 13 J gene segments, by nucleotide insertion (), and by nucleotide deletion from V (), D, and J () genes.</p> <p>This results in a diversity of an estimated 10⁶ different β chains per individual.</p> <p> <b>(B)</b> N-deletion causes shortening of the Vβ and Jβ segments.</p> <p>The number of nucleotides deleted from Vβ and Jβ germline DNA is limited.</p> <p>N-deletion of 192 published TCRβ mRNAs was determined.</p> <p>The figure shows the cumulative percentage of CDR3βs for the number of nucleotides deleted.</p> <p>TCRβ's with n nucleotides deleted represent approximately 10% of the repertoire if n = 0 to 6, and 5%, if n = 7 to 9.</p> <p> <b>(C)</b> The T-array protocol: <b>(C1)</b> cDNA from T-cells is generated.</p> <p> <b>(C2)</b> CDR3β regions are PCR amplified using biotinylated Vβ-specific () or Vβ-generic primers (not shown here).</p> <p> <b>(C3)</b> Biotinylated strands are removed after alkaline denaturation using streptavidin-coated beads.</p> <p> <b>(c4)</b> Single-strands of polyclonal TCRs are aliquoted and hybridized to fluorescently labeled annealers () complementary to the NDN-adjacent end of a Jβ gene.</p> <p>A specific number of Jβ-gene nucleotides (n) is deleted for each annealer, accounting for N-deletion during the VDJ recombination process.</p> <p>Insert (C4): Each annealer will hybridize to TCRβ rearrangements where n nucleotides are deleted from the Jβ-germline gene segment (<b>C4A</b>) or where less than n nucleotides are deleted (<b>C4B</b>).</p> <p> <b>(C5)</b> The annealer-hybridized fractions are loaded on universal hexamer arrays for <b>(C6)</b> T-cell-clone-specific ligation and, <b>(C7)</b> subsequently washed, scanned and analyzed.</p></div

Clonal expansion of T-cells from a CMV⁺ donor after antigen specific stimulation.

<div><p> <b>(panel A)</b> The fraction of antigen specific T-cell clones determined with NLVPMVATV-loaded tetramers.</p> <p> <b>(panel B)</b> Spectratyping of unsorted Vβ13⁺ and Vβ13⁺/Jβ1-2⁺ fraction.</p> <p> <b>(panel C)</b> CDR3 sequence of the clone identified compared to the Jβ1-2 germline sequence.</p> <p> <b>(panel D)</b> T-array of unsorted Vβ13⁺/Jβ1-2⁺ fraction.</p> <p>The annealer oligonucleotide used in this T-array experiment had the sequence ACTATGGCTACACCTTCGGTT, allowing detection of rearrangements with 3 or less nucleotides deleted from the Jβ1-2 germline.</p> <p>The arrow indicates sequence CCTTTT, the first nucleotides of the NDNβ region of the dominant T-cell clone that was identified in this screen.</p></div

Ligation experiments with Jurkat CDR3β amplicons.

<div><p> <b>(A)</b> VDJ rearrangement of Jurkat TCRβ.</p> <p>In this CDR3 sequence, there are 3 and 0 nucleotides deleted form the germline Vβ and Jβ, respectively.</p> <p> <b>(B–E)</b> Capillary-electrophoresis chromatograms showing length and signal of fluorescent annealers ().</p> <p> <b>(B)</b> A hexamer (GTTCGG) complementary to the Jurkat 3-end NDN sequence elongated (<b>*</b>) the Jβ1-2-specific annealer (♦).</p> <p> <b>(C)</b> The non-complementary 5′-end hexamer failed to cause elongation.</p> <p>Black peaks: Cy5 signal; Red peaks: FAM signal of size standards.</p> <p> <b>(D, E)</b> Similarly, a Cy5-labeled oligonucleotide complementary to the 3′ coding end of Vβ12, was elongated (<b>*</b>) only in the presence of the hexamer GTCGAG which is complementary to the 5′-end of the NDN sequence.</p> <p> <b>(F)</b> Detail of universal hexamer array after ligation of a Cy5-labeled oligonucleotide complementary to the 5′ coding end of Jβ1-2 in the presence of the antisense strand template of Jurkat CDR3β.</p> <p> <b>(G)</b> Signal intensities of all 4096 spots of the same array experiment.</p> <p>The arrow in (F) and (G) indicates the microarray spot with sequence GTTCGG.</p> <p> <b>(H)</b> List of 20 strongest spots with their hexamer sequence and Cy5-fluorescent signal.</p></div

table_1.XLSX

<p>Previous studies revealed high incidence of acquired N-glycosylation sites acquired N-glycosylation sites in RNA transcripts encoding immunoglobulin heavy variable region (IGHV) 3 genes from parotid glands of primary Sjögren’s syndrome (pSS) patients. In this study, next generation sequencing was used to study the extent of ac-Nglycs among clonally expanded cells from all IGVH families in the salivary glands of pSS patients. RNA was isolated from parotid gland biopsies of five pSS patients and five non-pSS sicca controls. IGHV sequences covering all functional IGHV genes were amplified, sequenced, and analyzed. Each biopsy recovered 1,800–4,000 unique IGHV sequences. No difference in IGHV gene usage was observed between pSS and non-pSS sequences. Clonally related sequences with more than 0.3% of the total number of sequences per patient were referred to as dominant clone. Overall, 70 dominant clones were found in pSS biopsies, compared to 15 in non-pSS. No difference in percentage mutation in dominant clone-derived IGHV sequences was seen between pSS and non-pSS. In pSS, no evidence for antigen-driven selection in dominant clones was found. We observed a significantly higher amount of ac-Nglycs among pSS dominant clone-derived sequences compared to non-pSS. Ac-Nglycs were, however, not restricted to dominant clones or IGHV gene. Most ac-Nglycs were detected in the framework 3 region. No stereotypic rheumatoid factor rearrangements were found in dominant clones. Lineage tree analysis showed in four pSS patients, but not in non-pSS, the presence of the germline sequence from a dominant clone. Presence of germline sequence and mutated IGHV sequences in the same dominant clone provide evidence that this clone originated from a naïve B-cell recruited into the parotid gland to expand and differentiate locally into plasma cells. The increased presence of ac-Nglycs in IGHV sequences, due to somatic hypermutation, might provide B-cells an escape mechanism to survive during immune response. We speculate that glycosylation of the B-cell receptor makes the cell sensitive to environmental lectin signals to contribute to aberrant B-cell selection in pSS parotid glands.</p

Additional file 1 of Systematic evaluation of B-cell clonal family inference approaches

Additional file 1: Supplementary Figure 1. Data simulation pipeline. Simulation approach is an integration of ImmuneSim, Alakazam and SHazaM tools and equally use the data of CF groupings obtained from each of the 10 CF inference approaches. Supplementary Figure 2. Determination of the number of TP, TN, FP, and FN. Three simulated CFs (2 singletons) and two inferred CFs are shown. Supplementary Figure 3. Overall correlation between the log10(number of CFs) and the standardized sequence depth for all combinations of approach (except SCOPer; A7, A8) and dataset. Supplementary Figure 4. Overall trend between the log10(number of CFs) and the standardized mutation load for all combinations of approach (except SCOPer; A7, A8) and dataset. Supplementary Figure 5. Summary of significant pairwise comparisons between Approaches. Supplementary Figure 6. Number of TP, TN, FP, and FN cases produced by the ten approaches when applied to six samples from three simulated datasets (D10, D11, D12). Supplementary Figure 7. Normalized number of TP, TN, FP, and FN cases produced by the ten approaches when applied to six samples from three simulated datasets (D10, D11, D12)

Impact of sequence variation of the TCR α chain on CD4⁺/CD8⁺ propensity.

<p>We analyzed 19,501 and 28,572 unique TCR α transcripts of naïve CD4⁺ and CD8⁺ T cells, respectively, from 5 healthy donors. The odds ratio (OR) is plotted for (<b>A</b>) each Vα gene segment and (<b>B</b>) each Jα gene segment, with OR < 1 indicating a propensity towards CD8⁺ and OR > 1 indicating a propensity towards CD4⁺. Total number of observations for each gene is listed. Significant associations after Bonferroni correction are denoted with an asterisk. (<b>C</b>) Odds ratios were computed for TCRs as a function of the calculated CDR3α net charge (error bars reflect 95% confidence intervals). A histogram of the number of observations is also plotted. Negative charge increases propensity of T cell towards CD8⁺ whereas positive charge increases propensity of T cell towards CD4⁺.</p

Percentage of CD4+/CD8+ propensity explained by V-genes, J-genes and CDR3-net charge².

<p>¹Calculated as the difference between the Nagelkerke R² of the null regression model (which only accounts for individual-specific effects) and the Nagelkerke R² of an alternative model (which also includes the contribution of V and J genes, CDR3 net charge and/or CDR3 length).</p><p>² Variation between different donors is shown in Table K in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0140815#pone.0140815.s001" target="_blank">S1 File</a>.</p><p>Percentage of CD4+/CD8+ propensity explained by V-genes, J-genes and CDR3-net charge<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0140815#t001fn002" target="_blank">²</a>.</p

DataSheet_1_TCRβ clones in muscle tissue share structural features in patients with idiopathic inflammatory myopathy and are associated with disease activity.docx

ObjectivesTo characterize the T cell receptor (TCRβ) repertoire in peripheral blood and muscle tissues of treatment naïve patients with newly diagnosed idiopathic inflammatory myopathies (IIMs).MethodsHigh throughput RNA sequencing of the TCRβ chain was performed in peripheral blood and muscle tissue in twenty newly-diagnosed treatment-naïve IIM patients (9 DM, 5 NM/OM, 5 IMNM and 1 ASyS) and healthy controls. Results thereof were correlated with markers of disease activity.ResultsMuscle tissue of IIM patients shows more expansion of TCRβ clones and decreased diversity when compared to peripheral blood of IIM as well as healthy controls (both p=0.0001). Several expanded TCRβ clones in muscle are tissue restricted and cannot be retrieved in peripheral blood. These clones have significantly longer CDR3 regions when compared to clones (also) found in circulation (p=0.0002), while their CDR3 region is more hydrophobic (pConclusionNetwork analysis of clones in muscle of IIM patients shows shared clusters of sequences across patients. Muscle-restricted CDR3 TCRβ clones show specific structural features in their T cell receptor. Our results indicate that clonal TCRβ expansion in muscle tissue might be associated with disease activity. Collectively, these findings support a role for specific clonal T cell responses in muscle tissue in the pathogenesis of the IIM subtypes studied.</p