Altered Expression of Human Smooth Muscle Myosin Phosphatase Targeting (MYPT) Isovariants with Pregnancy and Labor

<div><p>Background</p><p>Myosin light-chain phosphatase is a trimeric protein that hydrolyses phosphorylated myosin II light chains (MYLII) to cause relaxation in smooth muscle cells including those of the uterus. A major component of the phosphatase is the myosin targeting subunit (MYPT), which directs a catalytic subunit to dephosphorylate MYLII. There are 5 main MYPT family members (MYPT1 (PPP1R12A), MYPT2 (PPP1R12B), MYPT3 (PPP1R16A), myosin binding subunit 85 MBS85 (PPP1R12C) and TIMAP (TGF-beta-inhibited membrane-associated protein (PPP1R16B)). Nitric oxide (NO)-mediated smooth muscle relaxation has in part been attributed to activation of the phosphatase by PKG binding to a leucine zipper (LZ) dimerization domain located at the carboxyl-terminus of PPP1R12A. In animal studies, alternative splicing of PPP1R12A can lead to the inclusion of a 31-nucleotide exonic segment that generates a LZ negative (LZ-) isovariant rendering the phosphatase less sensitive to NO vasodilators and alterations in PPP1R12ALZ- and LZ+ expression have been linked to phenotypic changes in smooth muscle function. Moreover, PPP1R12B and PPP1R12C, but not PPP1R16A or PPP1R16B, have the potential for LZ+/LZ- alternative splicing. Yet, by comparison to animal studies, the information on human MYPT genomic sequences/mRNA expressions is scant. As uterine smooth muscle undergoes substantial remodeling during pregnancy we were interested in establishing the patterns of expression of human MYPT isovariants during this process and also following labor onset as this could have important implications for determining successful pregnancy outcome.</p><p>Objectives</p><p>We used cross-species genome alignment, to infer putative human sequences not available in the public domain, and isovariant-specific quantitative PCR, to analyse the expression of mRNA encoding putative LZ+ and LZ- forms of PPP1R12A, PPP1R12B and PPP1R12C as well as canonical PPP1R16A and PPP1R16B genes in human uterine smooth muscle from non-pregnant, pregnant and in-labor donors.</p><p>Results</p><p>We found a reduction in the expression of PPP1R12A, PPP1R12BLZ+, PPP1R16A and PPP1R16B mRNA in late pregnancy (not-in-labor) relative to non-pregnancy. PPP1R12ALZ+ and PPP1R12ALZ- mRNA levels were similar in the non-pregnant and pregnant not in labor groups. There was a further reduction in the uterine expression of PPP1R12ALZ+, PPP1R12CLZ+ and PPP1R12ALZ- mRNA with labor relative to the pregnant not-in-labor group. PPP1R12A, PPP1R12BLZ+, PPP1R16A and PPP1R16B mRNA levels were invariant between the not in labor and in-labor groups.</p><p>Conclusions</p><p>MYPT proteins are crucial determinants of smooth muscle function. Therefore, these alterations in human uterine smooth muscle MYPT isovariant expression during pregnancy and labor may be part of the important molecular physiological transition between uterine quiescence and activation.</p></div

Optimisation of primers directed against PPP1R12A, PPP1R12B, PPP1R12C, PPP1R16A and PPP1R16B isovariants.

<p>Panels above show PCR amplification and dissociation curves obtained for PPP1R12ALZ+, PPP1R12ALZ-, PPP1R12BLZ+, PPP1R12BLZ-, PPP1R12CLZ+, PPP1R12CLZ-, PPP1R16A and PPP1R16B Curves labelled A-E are representative of specific product formation obtained from human smooth muscle reference cDNA and human uterine cDNA samples. Similar curves were obtained for other positive controls including human skeletal and cardiac muscle samples. No specific products were obtained in reactions where the RT enzyme was excluded (RT-) or in water no template control (NTC) reactions. No specific products were obtained with PPP1R12BLZ- or PPP1R12CLZ- primer sets.</p

Schematic representation of the exon map of mammalian PPP1R12A, PPP1R12B and PPP1R12C leucine zipper positive (LZ+) isovariants.

<p>A-C. The NCBI accession numbers, nucleotide sequence identity and exon map of known MYPT LZ positive isovariants are shown. Nucleotide and amino acid sequences depicting the 4-heptad leucine repeat within the carboxyl-terminal exons are also displayed above.</p

Exon map of ‘predicted’ human PPP1R12A, PPP1R12B and PPP1R12C LZ negative (LZ-) isovariants.

<p>The inferred LZ- exon maps, predicted amino acid and nucleotide sequences of the terminal exons of PPP1R12A, PPP1R12B and PPP1R12C (A-C) are displayed above.</p

Details of donors used in this study.

<p>Details of donors used in this study.</p

Human uterine PPP1R16A and PPP1R16B mRNA expression is decreased during pregnancy and in labor.

<p>PPP1R16A and PPP1R16B mRNA expression in non-pregnant (NP), pregnant not in labor (NIL) and in-labor (IL) myometrium were assessed using quantitative RT-PCR. The amount of individual MYPT mRNA in each sample was determined from human reference smooth muscle standard curve and quantified as mean fold change relative to an internal calibrator. PPP1R16A and PPP1R16B expression was significantly less in NIL and IL myometrium than in NP myometrium. PPP1R16A and PPP1R16B mRNA expression was similar in the NIL and IL groups. The bars represent mean, *p<0.05.</p

Bioinformatic inference of putative human PPP1R12A, PPP1R12B and PPP1R12C LZ- isovariant sequences.

<p>The publicly available sequence information for chicken and mouse PPP1R12ALZ- isovariants are shown to display the 31 nucleotide exonic insert ‘GTGTCCGGCAAGAGTCAGTATCTACTGGGCG’. This generates a shift in the reading frame and a LZ negative read is located at the start of the black lettered exon. Cross-alignment with the human published PPP1R12A, PPP1R12B and PPP1R12C sequences enabled identification of the region to theoretically insert the 31 nucleotides. Doing so resulted in the translated LZ negative protein sequence ‘V[X]GKSQYLLGG’ of the chicken and mouse sequences also appearing in the predicted human LZ- sequences.</p

Details of Primers used for quantitative PCR.

<p>The primers were based in the human cDNA sequences. The HUGO/GeneBank accession numbers, oligonucleotide sequences, position and amplicon size are outlined below and in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0164352#pone.0164352.s002" target="_blank">S1 Table</a>.</p

SmAV co-immunoprecipitates with phosphotyrosine, ERK and FAK.

<p>A. Myometrial SmAV associates with tyrosine-phosphorylated proteins in a stretch-dependent manner. Stretch and unstretched term pregnant human uterine smooth muscle homogenates were immunoprecipitated (IP) with anti-phospho-tyrosine antibody and immunoblotted (IB) with SmAV antibody. **p<0.01 compared to unstretched control samples. The insert is a typical SmAV western blot with IP samples. n = 5. B. Myometrial SmAV associates with ERK protein in a stretch- dependent manner. Stretched and unstretched term samples were immunoprecipitated with anti- ERK antibody and immunoblotted with anti-SmAV antibody. SmAV densitometry was normalized to input signals. n = 6. **p<0.01, ***p<0.001. C. Confirmation of stretch induced ERK phosphorylation in human myometrium. Stretch and unstretched samples were immunoprecipitated with anti- ERK antibody and immunoblotted with phospho-ERK antibody. The p-ERK2 infrared signals were also normalized to input signals. n = 6. **p<0.01. D. Myometrial ERK associates with FAK in a stretch-dependent manner. Stretch and unstretched samples homogenates were immunoprecipitated with anti- ERK antibody and immunoblotted with phospho-FAK⁹²⁵ antibody. The p-FAK infrared signals were normalized to input signals. n = 6. ***p<0.001</p

Smooth muscle Archvillin (SmAV) in pregnant human myometrium is localized with vinculin at cell surface.

<p>Term, not-in-labor, human uterine smooth muscle strips were microdissected and stretched to 2 fold slack length for 7 minutes. The fresh frozen sections (10 sections for each sample) were stained with rabbit anti-SmAV and mouse anti-vinculin. Alexa-dye-conjugated goat secondary antibodies were used. Left column, SmAV (red); middle column vinculin (green); right column, merged image. Top panels, scale bar, 20 µm. Lower 3 panels, expanded magnification of boxed area in top merged image. SmAV localizes with the dense plaque maker vinculin (inset, white arrows) at cell surface. Scale bar, 10 µm, n = 3.</p