Internal dynamics in a DNA triple helix probed by (1)H-(15)N-NMR spectroscopy.

The amino group of adenine plays a key role in maintaining DNA triple helical structures, being the only functional group in DNA that is involved in both Watson-Crick and Hoogsteen hydrogen bonds. In the present work we have probed the internal dynamics of the adenine amino group in the intramolecular YRY triple helix formed by the 31-mer DNA oligonucleotide d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT). The DNA triple helix was specifically labeled with (15)N at the amino group of the adenine in the fifth position. The rotation rate of the labeled amino group was measured as a function of temperature using (1)H-(15)N heteronuclear NMR spectroscopy. The results indicate that, in the DNA triple helix, the rotation of the adenine amino group is greatly slowed relative to that in a DNA double helix. The temperature dependence of the rotation rate suggests a large entropic contribution to this effect, which may originate from different hydration patterns of the adenine amino group in the two structures

Site-resolved stabilization of a DNA triple helix by magnesium ions

Proton exchange and NMR spectroscopy have been used to define the effects of Mg(2+) ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg(2+) ions. The results reveal that Mg(2+) lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na(+) counterions to the same helix containing Mg(2+) counterions shows that these stabilizing effects result, in large part, from Mg(2+) ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C(+)·GC triads in determining the stability of DNA triple-helical structures

Site-Resolved Structural Energetics of the T7 Concatemer Junction

The concatemer junction is a conserved sequence of 8 bp, which is strategically located at the junction between the head-to-tail repeats of genomic DNA in T7 and related bacteriophages. The RNA polymerase pauses at this site to recruit the machinery necessary for cleavage of the concatemer into single genome DNA. During pausing, the transcription bubble collapses and the transcription RNA–DNA hybrid is shortened to only 3 bp. This work addresses the question of the role of the nucleic acid components of the transcription elongation complex in this collapse of the transcription bubble. The nucleic acid structures investigated are the DNA–DNA duplex structure present at the concatemer junction when the DNA is not transcribed and the RNA–DNA hybrid formed when the concatemer junction is transcribed. The structural energetics of each base pair in the two structures is characterized using imino proton exchange and nuclear magnetic resonance spectroscopy. The results show that 5 bp in the DNA–DNA duplex at the concatemer junction site are significantly more stable than the corresponding base pairs in the RNA–DNA hybrid that forms when the site is transcribed. Because of their energetic preference for the DNA–DNA duplex, these 5 bp favor the collapse of the transcription bubble. Four of the 5 bp with enhanced stability in the DNA–DNA duplex are located in the downstream half of the concatemer junction site. This location suggests that only after the entire concatemer junction is transcribed can the RNA–DNA hybrid accumulate sufficient structural destabilization to trigger the dissociation of the RNA and the switch of the DNA template strand from the hybrid structure to the DNA–DNA double-helical structure