Additional file 1: Figure S1a. of Development, genetic mapping and QTL association of cotton PHYA, PHYB, and HY5-specific CAPS and dCAPS markers

The examples of PHYBdCAPs-2 markers segregating among TM-1 × 3–79 RIL lines. (M) – Molecular-weight size marker of 25-bp ladder, ‘TM-1’ and ‘Pima 3–79’ – parents, F1 – first-generation hybrid, 13–51 – RIL individuals. Note: the 144-bp band is more intensive in G. hirsutum and the 180-bp band is more intensive in G. barbadense genotypes, while 36-bp band is not visible to detect. Heterozygots show two intensive bands of 180- and 144-bp, respectively. Primer information for PHYBdCAPs-2: F-5’GAAGATCATAAAAAGGCTATATACGTGGTGGTTA3’; R-5’CAAAGGATTGGGACTATGAACAATGG3’; Figure S1b. Genetic linkage maps with integration of PHYBdCAPs and PHYBdCAPs-2 corresponding to chromosome 10 of the A-sub-genome [48, 49]. QTL designations on the map are follows as Ns - nep size; Nn - number of neps; UQL - upper quartile of fiber length by weight; SFC - short fiber content by weight g; ALFw - average length of all fiber by weight; 5.0 L - fiber span length; 2.5 L - fiber span length; VFM – visible foreign matter in percentage; FTX - fiber fineness; IFC - immature fiber content by weight g; MR - maturity ratio; MT - mean tenacity; and ME - mean elongation. (DOCX 820 kb

Genetic variances and estimated broad-sense heritability of traits in the F₃ population.

<p>Genetic variances and estimated broad-sense heritability of traits in the F₃ population.</p

Genetic variances and estimated broad-sense heritability of photoperiod related traits in the F₂ population.

<p>Genetic variances and estimated broad-sense heritability of photoperiod related traits in the F₂ population.</p

The level of polymorphism of all SSR markers between parental genotypes.

<p>The level of polymorphism of all SSR markers between parental genotypes.</p

The cross-combination between the wild type of cotton species <i>G</i>. <i>darwinii</i> Watt with its photoperiod insensitive irradiation mutant line.

<p>A) Wild type, B) F₁ plant, and C) irradiation mutant line.</p

Linkage group (LG) / chromosome (Chr.) information in the F₂ population.

<p>Linkage group (LG) / chromosome (Chr.) information in the F₂ population.</p

Genetic linkage map of the F₃ population showing the location of QTL for photoperiodic flowering.

<p>Genetic linkage map of the F₃ population showing the location of QTL for photoperiodic flowering.</p

Genomic distributions of SSR markers and photoperiod-related QTLs identified in the F_2:3 mapping population of this study.

<p>Genomic distributions of SSR markers and photoperiod-related QTLs identified in the F_2:3 mapping population of this study.</p

Histogram of all recorded traits of flowering-time, photoperiodic flowering, other related to flowering and some morphological traits.

<p>a) flowering-time, b) node of first fruiting branch, c) number of buds, d) number of nodes, e) photoperiodic flowering, f) flowering duration Arrows show means for parental genotypes and F₁ hybrid; black arrow—wild type, white arrow—irradiation mutant, and arrow with patterned fill—F₁ plant.</p

Genetic linkage map of the F₂ population showing the location of QTL for photoperiodic flowering.

<p>Genetic linkage map of the F₂ population showing the location of QTL for photoperiodic flowering.</p