Molecular and clinical characteristics of ATP1A3-related diseases

ObjectiveWith detailed studies of ATP1A3-related diseases, the phenotypic spectrum of ATP1A3 has greatly expanded. This study aimed to potentially identify the mechanisms by which ATP1A3 caused neurological dysfunction by analyzing the clinical features and phenotypes of ATP1A3-related diseases, and exploring the distribution patterns of mutations in the subregions of the ATP1A3 protein, thus providing new and effective therapeutic approaches.MethodsDatabases of PubMed, Online Mendelian Inheritance in Man, and Human Gene Mutation Database, Wanfang Data, and Embase were searched for case reports of ATP1A3-related diseases. Following case screening, we collected clinical information and genetic testing results of patients, and analyzed the disease characteristics on the clinical phenotype spectrum associated with mutations, genetic characteristics of mutations, and effects of drug therapy.ResultsWe collected 902 clinical cases related to ATP1A3 gene. From the results of previous studies, we further clarified the clinical characteristics of ATP1A3-related diseases, such as alternating hemiplegia of childhood (AHC), rapid-onset dystonia-parkinsonism; cerebellar ataxia, areflexia, pes cavus, optic atrophy, and sensorineural hearing loss syndrome, and relapsing encephalopathy with cerebellar ataxia, frequency of mutations in different phenotypes and their distribution in gene and protein structures, and differences in mutations in different clinical phenotypes. Regarding the efficacy of drug treatment, 80 of the 124 patients with AHC were treated with flunarizine, with an effectiveness rate of ~64.5%.ConclusionsNervous system dysfunction due to mutations of ATP1A3 gene was characterized by a group of genotypic–phenotypic interrelated disease pedigrees with multiple clinical manifestations. The presented results might help guide the diagnosis and treatment of ATP1A3-related diseases and provided new ideas for further exploring the mechanisms of nervous system diseases due to ATP1A3 mutations

Genetic Polymorphisms in Enzymes Involved in One-Carbon Metabolism and Anti-epileptic Drug Monotherapy on Homocysteine Metabolism in Patients With Epilepsy

Aims: To investigate the effects of single nucleotide polymorphisms (SNPs) in genes of one-carbon metabolism (OCM) related enzymes and anti-epileptic drug (AED) monotherapy on homocysteine (Hcy) metabolism in patients with epilepsy, and to further explore specific SNPs that may increase patients' susceptibility to the effects of AEDs on the Hcy imbalance.Method: This case-control study analyzed 279 patients with epilepsy, including patients receiving monotherapy with valproate (VPA) (n = 53), oxcarbazepine (OXC) (n = 71), lamotrigine (LTG) (n = 55), or levetiracetam (LEV) (n = 35) and patients who had not taken any AEDs (controls, n = 65) for at least 6 months. Serum levels of vitamin B12 (vit B12), folate (FA) and Hcy were measured, and 23 SNPs in 13 genes of OCM-related enzymes were genotyped in all patients.Results: Methylenetetrahydrofolate reductase (MTHFR) rs1801133 was associated with elevated serum Hcy levels in patients with epilepsy (P < 0.001), and patients presenting the TT genotype exhibited higher serum Hcy levels than patients with the CC (P < 0.001) or CT (P < 0.001) genotype. A subsequent multiple linear regression analysis showed that AED monotherapy with VPA (vs. control: P = 0.023) or OXC (vs. control: P = 0.041), and genotypes of MTHFR rs1801133 TT (vs. CC: P < 0.001; vs. CT: P < 0.001), transcobalamin 2 (TCN2) rs1801198 CC (vs. GC: P = 0.039) and folate receptor 1 (FOLR1) rs2071010 AA (vs. GA: P = 0.031) were independent risk factors for higher Hcy levels. In the subgroup analysis of patients taking OXC, we found that patients with genotypes of MTHFR rs1801133 TT (vs. CC: P = 0.001; vs. CT: P < 0.001) and TCN2 rs1801198 CC (vs. GC: P = 0.021; vs. GG: P = 0.018) exhibited higher serum Hcy levels.Conclusions: VPA, OXC, and genotypes of MTHFR rs1801133 TT, TCN2 rs1801198 CC, and FOLR1 rs2071010 AA are all independent risk factors for elevated Hcy levels in patients with epilepsy. Moreover, genotypes of MTHFR rs1801133 TT and TCN2 rs1801198 CC may increase patients' susceptibility to the effect of OXC on disrupting Hcy homeostasis

Effects of antiepileptic drugs on endocrine function and woman reproduction

DOI：10.3969/j.issn.1672-6731.2011.04.00

STE20/SPS1-related proline/alanine-rich kinase is involved in plasticity of GABA signaling function in a mouse model of acquired epilepsy.

The intracellular concentration of chloride ([Cl(-)]i) determines the strength and polarity of GABA neurotransmission. STE20/SPS1-related proline/alanine-rich kinase (SPAK) is known as an indirect regulator of [Cl(-)]i for its activation of Na-K-2 Cl(-)co-transporters (NKCC) and inhibition of K-Cl(-)co-transporters (KCC) in many organs. NKCC1 or KCC2 expression changes have been demonstrated previously in the hippocampal neurons of mice with pilocarpine-induced status epilepticus (PISE). However, it remains unclear whether SPAK modulates [Cl(-)]i via NKCC1 or KCC2 in the brain. Also, there are no data clearly characterizing SPAK expression in cortical or hippocampal neurons or confirming an association between SPAK and epilepsy. In the present study, we examined SPAK expression and co-expression with NKCC1 and KCC2 in the hippocampal neurons of mice with PISE, and we investigated alterations in SPAK expression in the hippocampus of such mice. Significant increases in SPAK mRNA and protein levels were detected during various stages of PISE in the PISE mice in comparison to levels in age-matched sham (control) and blank treatment (control) mice. SPAK and NKCC1 expression increased in vitro, while KCC2 was down-regulated in hippocampal neurons following hypoxic conditioning. However, SPAK overexpression did not influence the expression levels of NKCC1 or KCC2. Using co-immunoprecipitation, we determined that the intensity of interaction between SPAK and NKCC1 and between SPAK and KCC2 increased markedly after oxygen-deprivation, whereas SPAK overexpression strengthened the relationships. The [Cl(-)]i of hippocampal neurons changed in a corresponding manner under the different conditions. Our data suggests that SPAK is involved in the plasticity of GABA signaling function in acquired epilepsy via adjustment of [Cl(-)]i in hippocampal neurons

Effects of antiepileptic drug monotherapy on one-carbon metabolism and DNA methylation in patients with epilepsy.

The aim of this study was to compare the serum levels of one-carbon metabolism (OCM) nutrients (e.g., folate, homocysteine and vitamin B12) and peripheral blood DNA methylation in epileptic patients under treatment with antiepileptic drugs (AEDs) and in healthy controls.In this cross-sectional study, 60 patients with epilepsy who were receiving valproate (VPA) (n = 30) or lamotrigine (LTG) (n = 30) monotherapy were enrolled. Thirty age and sex matched healthy subjects served as the controls. Serum concentrations of OCM nutrients and peripheral blood DNA methylation status were measured.Compared to the control group, the VPA group had higher serum levels of homocysteine (p<0.05). No difference in homocysteine concentration was observed in the LTG group. Patients receiving VPA or LTG had significantly lower serum folate levels in comparison with controls (p<0.001). The level of methylation of long interspersed nucleotide element-1 (LINE-1) in peripheral blood was not significantly different between the AED monotherapy group and healthy controls. A difference in the methylation levels of methylenetetrahydrofolate reductase (MTHFR) amplicon was observed between AED-treated patients with epilepsy and controls (p<0.01). A positive correlation between serum folate levels and peripheral blood MTHFR amplicon methylation status was also observed (r = 0.25, p = 0.023).Our findings suggest that the effects of AED monotherapy on OCM may induce specific regions of DNA hypomethylation

Details of measured amplicons and PCR primers.

<p><i>Abbreviations</i>: LINE-1: long interspersed nucleotide element-1; MTHFR: methylenetetrahydrofolate reductase.</p><p>¹10mer space tag is added at the 5’ primer end with the following sequence: 5’- aggaagagag+primer</p><p>²T7 promoter is added at the 5’ primer end with the following sequence: 5’- cagtaatacgactcactatagggagaaggct+primer</p><p>Details of measured amplicons and PCR primers.</p

Comparison of serum OCM nutrient levels among the control, LTG and VPA groups.

<p>A serum Hcy levels, B serum FA levels and C serum VitB12 levels. *P<0.05. <i>Abbreviations</i>: Hcy: homocysteine; FA: folate; VitB12: vitamin B12; LTG: lamotrigine; VPA: valproate.</p

Association of LEPR and ANKK1 gene polymorphisms with weight gain in epilepsy patients receiving valproic acid

Background: Weight gain is the most frequent adverse effect of valproic acid (VPA) treatment, resulting in poor compliance and many endocrine disturbances. Similarities in the weight change of monozygotic twins receiving VPA strongly suggests that genetic factors are involved in this effect. However, few studies have been conducted to identify the relevant genetic polymorphisms. Additionally, the causal relationship between the VPA concentration and weight gain has been controversial. Thus, we investigated the effects of single nucleotide polymorphisms (SNPs) in several appetite stimulation and energy homeostasis genes and the steady state plasma concentrations (Css) of VPA on the occurrence of weight gain in patients. Methods: A total of 212 epilepsy patients receiving VPA were enrolled. Nineteen SNPs in 11 genes were detected using the Sequenom MassArray iPlex platform, and VPA Css was determined by high-performance liquid chromatography (HPLC). Results: After 6 months of treatment, 20.28% of patients were found to gain a significant amount of weight (weight gained ≥7%). Three SNPs in the leptin receptor (LEPR), ankyrin repeat kinase domain containing 1 (ANKK1), and α catalytic subunit of adenosine monophosphate-activated protein kinase (AMPK) showed significant associations with VPA-induced weight gain (p Conclusions: LEPR and ANKK1 genetic polymorphisms may have value in predicting VPA-induced weight gain.</p

Alterations in expression of SPAK and CCCs in cultured hippocampal neurons after SPAK overexpression and/or oxygen deprivation.

<p>(a), (b) SPAK expression level increases after oxygen deprivation in various groups. The bands with molecular weights of 67 kDa and 95 kDa represent endogenous and exogenous SPAK, respectively. (c) (d) NKCC1 expression level increases after oxygen-deprivation in various groups. NKCC1 expression level does not change following SPAK overexpression in any condition. (d) (e) KCC2 expression declines after oxygen-deprivation in various groups. KCC2 expression levels do not change following SPAK overexpression in any condition. NoI: non-infection group. NeI: negative infection group. SO: SPAK overexpression group. OD: oxygen-deprivation. NOD: non-oxygen-deprivation. Values are mean ± SD, ^#<i>P</i><0.05 versus the non-oxygen-deprivation group.</p

A Methylation levels of LINE-1 among the control, LTG and VPA groups.

<p>B Methylation levels of informative CpG units in LINE-1 among the control, LTG and VPA groups. *P<0.05. <i>Abbreviations</i>: <i>LINE-1</i>: long interspersed nucleotide element-1; LTG: lamotrigine; VPA: valproate.</p