miPEPPred-FRL: A Novel Method for Predicting Plant MiRNA-Encoded Peptides Using Adaptive Feature Representation Learning

MicroRNAs (miRNAs) are an essential type of small molecule RNAs that play significant regulatory roles in organisms. Recent studies have demonstrated that small open reading frames (sORFs) harbored in primary miRNAs (pri-miRNAs) can encode small peptides, known as miPEPs. Plant miPEPs can increase the abundance and activity of cognate miRNAs by promoting the transcription of their corresponding pri-miRNAs, thereby modulating plant traits. Biological experiments are the most effective way to accurately identify miPEPs; however, they are time-consuming and expensive. Hence, an efficient computational method for the identification of miPEPs on a large scale is highly desirable. Up to now, there have been no specialized computational tools for identifying miPEPs. In this work, a novel predictor named miPEPPred-FRL based on an adaptive feature representation learning framework that consists of the feature transformation module and the cascade architecture has been proposed. The feature transformation module integrating a newly designed feature selection method and classifier selection rule is developed to convert sequence-based features into primary class and probabilistic features, which are then fed into the improved cascade architecture to obtain more stable and discriminative augmented features. Finally, the augmented features are utilized to construct the final predictor. Cross-validation experiments illustrate that the novel feature selection method and classifier selection rule contribute to boosting the feature representation ability of the framework. Furthermore, the high accuracy of miPEPPred-FRL on independent testing data suggests that it is a trustworthy and valuable tool for the identification of miPEPs

Facilitating Electron Transportation in Perovskite Solar Cells via Water-Soluble Fullerenol Interlayers

TiO₂ is widely used in perovskite solar cells (Pero-SCs), but its low electrical conductivity remains a drawback for application in electron transport layer (ETL). To overcome this problem, an easily accessible hydroxylated fullerene, fullerenol, was employed herein as ETL modified on ITO in <i>n</i>-<i>i</i>-<i>p</i> type (ITO as cathode) Pero-SCs for the first time. The results showed that the insertion of a single layer of fullerenol between perovskite and TiO₂ dramatically facilitates the charge transportation and decreases the interfacial resistance. As a consequence, the device performance was greatly improved, and a higher power conversion efficiency of 14.69% was achieved, which is ∼17.5% enhancement compared with that (12.50%) of the control device without the fullerenol interlayer. This work provides a new candidate of interfacial engineering for facilitating the electron transportation in Pero-SCs

Effects of different reaction conditions on <i>de novo</i> RNA synthesis.

<p>(A) The template, (−)-RNA1_1–201 with its 3′-end blocked, was incubated with the MBP-Pro A at different temperature. Reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription. (B) The synthesized RNA products from the experiments in (A) were measured via Bio-Rad Quantity One software Error bars represent the standard deviation (S.D.) values from at least three independently repeated experiments. (C) The template (−)-RNA1_1–201 with its 3′-end blocked, was incubated with the MBP-Pro A at the different pH. Reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription. (D) The synthesized RNA products from the experiments in (C) were measured via Bio-Rad Quantity One software Error bars represent the standard deviation (S.D.) values from at least three independently repeated experiments. (E) The template, (−)-RNA1_1–201 with its 3′-end blocked, was incubated with the MBP-Pro A and different concentrations of Mn²⁺. Reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription. (F) The synthesized RNA products from the experiments in (E) were measured via Bio-Rad Quantity One software Error bars represent the standard deviation (S.D.) values from at least three independently repeated experiments.</p

Effects of RdRP inhibitors.

<p>(A) The blocked (+)-RNA1_1–191 template was reacted with MBP-Pro A under the presence or absence of indicated conditions, such as standard condition (lane 2), heat at 95°C for 2 min (lane 3), 20 mM EDTA (lane 4), or 0.6% SDS (lane 5). Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription. (B) The blocked (+)-RNA1_1–191 template was reacted with MBP-Pro A in the presence of RdRP inhibitor PAA (lanes 3–5) or gliotoxin (lanes 6–8) at the indicated concentrations. Lane 1, DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase. The reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”.</p

Chemical Modification of <i>n</i>‑Type-Material Naphthalene Diimide on ITO for Efficient and Stable Inverted Polymer Solar Cells

To provide orthogonal solvent processable surface modification and improve the device stability of bulk-heterojunction polymer solar cells (PSCs), <i>n</i>-type semiconducting material naphthalene diimide (NDI) was chemically introduced onto the ITO surface as a cathode interlayer (CIL) using 3-bromo­propyl­tri­meth­oxy­silane (BrTMS) as a coupling agent. After modification, the work function of ITO can be decreased from 4.70 to 4.23 eV. The modified ITO cathode was applied in inverted PSCs based on PTB7-Th:PC₇₁BM. With the CIL modification, a champion power conversion efficiency (PCE) of 5.87% was achieved, showing a dramatic improvement compared to that of devices (PCE = 3.58%) without CIL. More importantly, with these chemical bonded interlayers, the stability of inverted PSCs was greatly enhanced. The improved PCE and stability can be attributed to the increased open-circuit voltage and the formation of robust chemical bonds in NDI-TMS films, respectively. This study demonstrated that chemical modification of ITO with <i>n</i>-type semiconducting materials provides an avenue for not only solving the solvent orthogonal problem but also improving the device performance in terms of the PCE and the stability

Water-Soluble 2D Transition Metal Dichalcogenides as the Hole-Transport Layer for Highly Efficient and Stable p–i–n Perovskite Solar Cells

As a hole-transport layer (HTL) material, poly­(3,4-ethylenedioxythiophene):polystyrene-sulfonate (PEDOT:PSS) was often criticized for its intrinsic acidity and hygroscopic effect that would in the long run affect the stability of perovskite solar cells (Pero-SCs). As alternatives, herein water-soluble two-dimensional (2D) transition metal dichalcogenides (TMDs), such as MoS₂ and WS₂ were used as HTLs in p–i–n Pero-SCs. It was found that the content of 1T phase in 2D TMDs HTLs is centrally important to the power conversion efficiencies (PCEs) of Pero-SCs, and the 1T-rich TMDs (as achieved from exfoliation and without postheating) lead to much higher PCEs. More importantly, as PEDOT:PSS was replaced by 2D TMDs, both the PCEs and stability of Pero-SCs were significantly improved. The highest PCEs of 14.35 and 15.00% were obtained for the Pero-SCs with MoS₂ and WS₂, respectively, whereas the Pero-SCs with PEDOT:PSS showed a highest PCE of only 12.44%. These are up to date the highest PCEs using 2D TMDs as HTLs. After being stored in a glovebox for 56 days, PCEs of the Pero-SCs using MoS₂ and WS₂ HTLs remained 78 and 72%, respectively, whereas the PCEs of Pero-SCs with PEDOT:PSS almost dropped to 0 over 35 days. This study demonstrates that water-soluble 2D TMDs have great potential for application as new generation of HTLs aiming at high performance and long-term stable Pero-SCs

FHV protein A initiates RNA synthesis via a <i>de novo</i> mechanism.

<p>(A) The template, (−)-RNA1_1–201 with its 3′-end blocked, was incubated with the MBP-Pro A and different concentrations specific RNA primer. Reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription. (B) The synthesized RNA products from the experiments in (A) were measured via Bio-Rad Quantity One software, and the relative RdRP activities were determined by comparing the RNA product level in the presence of the indicated concentration of primer with the RNA product level without the primer. Error bars represent the standard deviation (S.D.) values from at least three independently repeated experiments.</p

The RdRP activities of protein A depend on the 3′-proximal nucleotides of RNA1.

<p>(A) The (−)RNA and (+)RNA templates/substrates with different 3′-end sequences are shown. (B) The 3′-OH blocked (+)RNA templates with 3′ -proximal deletion of 0 to 49 nucleotides (lanes 2–7) were reacted with MBP-Pro A as indicated. The templates and RdRP reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. (C) The 3′-OH blocked (−)RNA substrates with 3′-proximal deletion of 0 to 7 nucleotides (lanes 2–6) were reacted with MBP-Pro A as indicated. The substrates and reaction products were analyzed and detected as described in “Materials and Methods”. (D) The blocked (−)-RNA1_1–201A3G, (−)-RNA1_1–201A3C and (−)-RNA1_1–201A3U were reacted with MBP-Pro A. Templates and reaction products were analyzed and detected as described in “Materials and Methods”. (E) The blocked (−)-RNA1_3–201A3G, (−)-RNA1_3–201A3C and (−)-RNA1_3–201A3U templates were reacted with MBP-Pro A. Templates and reaction products were analyzed and detected as described in “Materials and Methods”. For (B-E), lane 1 represents synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription.</p

FHV protein A possesses TNTase activity.

<p>(A) The (−)-RNA1_1–201 substrate was reacted with MBP-Pro A with DIG-labeled UTP mix (65% DIG-labeled UTP together with 35% UTP) in the absence (lane 3) or presence of indicated NTPs (lanes 2, 4–9). (B) The (−)-RNA1_1–201 (lanes 1–4) or (+)-RNA1_1–191 (lanes 5–8) substrates as well as DIG-labeled UTP mix were reacted with MBP-Pro A or MBP-Pro A_GAA as indicated, in the absence (lanes 1, 2, 5, and 6) or presence (lanes 3, 4, 7 and 8) of ATP, CTP, and GTP mix. (C) The (−)-RNA1_1–201 (lanes 2–5) or (+)-RNA1_1–191 (lanes 6–9) substrates were intact (lanes 2, 3, 6 and 7) or 3′-end blocked by oxidation (lanes 4, 5, 8 and 9). The indicated substrates were incubated with DIG-labeled UTP mix in the presence or absence of ATP, CTP, and GTP mix. For (A–C), the substrates and TNTase reaction products were analyzed and detected as described in “Materials and Methods”.</p

FHV protein A possesses RdRP activity.

<p>(A) Electrophoresis analysis of purified MBP-Pro A and its mutants. Lane M, molecular weight markers (in kDa); Lane 1, MBP-Pro A; Lane 2, MBP-Pro A_GAA, the MBP fusion GDD-to-GAA mutant protein A. (B) Schematic of the RNA templates used for RdRP assays. (C) The indicated template, intact or with its 3′ end blocked via oxidation, was incubated with the indicated proteins and DIG RNA Labeling mix. The reaction products were by electrophoresis on a denaturing formaldehyde-agarose gel and detected.Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription (D) The blocked template (−)-RNA1_1–201 was incubated with the indicated proteins. Templates and reaction products were analyzed and detected as in (C). (E) The blocked template (+)-RNA1_1–191 was incubated with the indicated proteins. Templates and reaction products were analyzed on denaturing formaldehyde-agarose gel and detected via Northern blot analysis using the DIG-labeled probes 2 and DIG-labeled probes 3 (GUUCUAGCCCGAAAGGGCAGAGGU). (F) The RNA products synthesized in (C) and (D) were subjected to RT-PCR. Reverse transcription was conducted in the presence or absence of specific RT primers, followed by PCR amplification. PCR products were electrophoresed through 1.0% agarose gel and visualized by ethidium bromide staining. Lane 1, DNA ladder.</p