Determination of 55 Veterinary Antibiotics in Chicken Manure Using Ultra-High-Performance Liquid Chromatography – Tandem Mass Spectrometry (UPLC-MS/MS)

A highly efficient method for the detection and quantification of 55 veterinary antibiotics (VAs) in chicken manure belonging to six drug classes using solid-phase extraction (SPE) and ultrahigh-performance liquid chromatography–tandem mass spectrometry (UPLC–MS/MS) was developed. The mixture of EDTA–McIlvaine buffer (pH 3.0) and the organic extractant (methanol–acetonitrile, 1:3, v/v) was used to isolate the target VAs from freeze-dried chicken manure. The extract was purified by a hydrophile–lipophile balance cartridge. All antibiotics showed excellent linear relationships in the range between 1 and 100 µg/kg with the coefficients of determination of the standard curves above 0.990. The recoveries of antibiotics were between 35.66% and 103.54% using matrix-matched calibration for quantification. The limits of detection and quantification were from 0.01 to 1.59 µg/kg and 0.04 to 4.76 µg/kg, respectively. The method was demployed to determine VAs in chicken manure from 12 farms, revealing contamination in all samples. A total of 13 VAs belonging to six classes were detected with concentrations up to 41.47 mg/kg. The presence of high concentrations of antibiotic residues in poultry manure poses a potential risk for environmental contamination. This work has identified significant differences in the types of VAs compared to literature reports. Additionally, it detected pleuromutilin antibiotics in chicken manure for the first time.</p

Effects of RdRP inhibitors.

<p>(A) The blocked (+)-RNA1_1–191 template was reacted with MBP-Pro A under the presence or absence of indicated conditions, such as standard condition (lane 2), heat at 95°C for 2 min (lane 3), 20 mM EDTA (lane 4), or 0.6% SDS (lane 5). Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription. (B) The blocked (+)-RNA1_1–191 template was reacted with MBP-Pro A in the presence of RdRP inhibitor PAA (lanes 3–5) or gliotoxin (lanes 6–8) at the indicated concentrations. Lane 1, DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase. The reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”.</p

Effects of different reaction conditions on <i>de novo</i> RNA synthesis.

<p>(A) The template, (−)-RNA1_1–201 with its 3′-end blocked, was incubated with the MBP-Pro A at different temperature. Reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription. (B) The synthesized RNA products from the experiments in (A) were measured via Bio-Rad Quantity One software Error bars represent the standard deviation (S.D.) values from at least three independently repeated experiments. (C) The template (−)-RNA1_1–201 with its 3′-end blocked, was incubated with the MBP-Pro A at the different pH. Reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription. (D) The synthesized RNA products from the experiments in (C) were measured via Bio-Rad Quantity One software Error bars represent the standard deviation (S.D.) values from at least three independently repeated experiments. (E) The template, (−)-RNA1_1–201 with its 3′-end blocked, was incubated with the MBP-Pro A and different concentrations of Mn²⁺. Reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription. (F) The synthesized RNA products from the experiments in (E) were measured via Bio-Rad Quantity One software Error bars represent the standard deviation (S.D.) values from at least three independently repeated experiments.</p

FHV protein A initiates RNA synthesis via a <i>de novo</i> mechanism.

<p>(A) The template, (−)-RNA1_1–201 with its 3′-end blocked, was incubated with the MBP-Pro A and different concentrations specific RNA primer. Reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription. (B) The synthesized RNA products from the experiments in (A) were measured via Bio-Rad Quantity One software, and the relative RdRP activities were determined by comparing the RNA product level in the presence of the indicated concentration of primer with the RNA product level without the primer. Error bars represent the standard deviation (S.D.) values from at least three independently repeated experiments.</p

The RdRP activities of protein A depend on the 3′-proximal nucleotides of RNA1.

<p>(A) The (−)RNA and (+)RNA templates/substrates with different 3′-end sequences are shown. (B) The 3′-OH blocked (+)RNA templates with 3′ -proximal deletion of 0 to 49 nucleotides (lanes 2–7) were reacted with MBP-Pro A as indicated. The templates and RdRP reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. (C) The 3′-OH blocked (−)RNA substrates with 3′-proximal deletion of 0 to 7 nucleotides (lanes 2–6) were reacted with MBP-Pro A as indicated. The substrates and reaction products were analyzed and detected as described in “Materials and Methods”. (D) The blocked (−)-RNA1_1–201A3G, (−)-RNA1_1–201A3C and (−)-RNA1_1–201A3U were reacted with MBP-Pro A. Templates and reaction products were analyzed and detected as described in “Materials and Methods”. (E) The blocked (−)-RNA1_3–201A3G, (−)-RNA1_3–201A3C and (−)-RNA1_3–201A3U templates were reacted with MBP-Pro A. Templates and reaction products were analyzed and detected as described in “Materials and Methods”. For (B-E), lane 1 represents synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription.</p

FHV protein A possesses TNTase activity.

<p>(A) The (−)-RNA1_1–201 substrate was reacted with MBP-Pro A with DIG-labeled UTP mix (65% DIG-labeled UTP together with 35% UTP) in the absence (lane 3) or presence of indicated NTPs (lanes 2, 4–9). (B) The (−)-RNA1_1–201 (lanes 1–4) or (+)-RNA1_1–191 (lanes 5–8) substrates as well as DIG-labeled UTP mix were reacted with MBP-Pro A or MBP-Pro A_GAA as indicated, in the absence (lanes 1, 2, 5, and 6) or presence (lanes 3, 4, 7 and 8) of ATP, CTP, and GTP mix. (C) The (−)-RNA1_1–201 (lanes 2–5) or (+)-RNA1_1–191 (lanes 6–9) substrates were intact (lanes 2, 3, 6 and 7) or 3′-end blocked by oxidation (lanes 4, 5, 8 and 9). The indicated substrates were incubated with DIG-labeled UTP mix in the presence or absence of ATP, CTP, and GTP mix. For (A–C), the substrates and TNTase reaction products were analyzed and detected as described in “Materials and Methods”.</p

FHV protein A possesses RdRP activity.

<p>(A) Electrophoresis analysis of purified MBP-Pro A and its mutants. Lane M, molecular weight markers (in kDa); Lane 1, MBP-Pro A; Lane 2, MBP-Pro A_GAA, the MBP fusion GDD-to-GAA mutant protein A. (B) Schematic of the RNA templates used for RdRP assays. (C) The indicated template, intact or with its 3′ end blocked via oxidation, was incubated with the indicated proteins and DIG RNA Labeling mix. The reaction products were by electrophoresis on a denaturing formaldehyde-agarose gel and detected.Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated <i>in vitro</i> transcription (D) The blocked template (−)-RNA1_1–201 was incubated with the indicated proteins. Templates and reaction products were analyzed and detected as in (C). (E) The blocked template (+)-RNA1_1–191 was incubated with the indicated proteins. Templates and reaction products were analyzed on denaturing formaldehyde-agarose gel and detected via Northern blot analysis using the DIG-labeled probes 2 and DIG-labeled probes 3 (GUUCUAGCCCGAAAGGGCAGAGGU). (F) The RNA products synthesized in (C) and (D) were subjected to RT-PCR. Reverse transcription was conducted in the presence or absence of specific RT primers, followed by PCR amplification. PCR products were electrophoresed through 1.0% agarose gel and visualized by ethidium bromide staining. Lane 1, DNA ladder.</p

Gold(I)-Catalyzed Angle Strain Controlled Strategy to Furopyran Derivatives from Propargyl Vinyl Ethers: Insight into the Regioselectivity of Cycloisomerization

A unique strategy for the regiospecific synthesis of bicyclic furopyran derivatives has been developed via a gold­(I)-catalyzed propargyl-Claisen rearrangement/6-<i>endo-trig</i> cyclization of propargyl vinyl ethers. The introduction of angle strain into the substrates significantly altered the reaction’s regioselectivity. Insight into the regioselectivity of the cycloisomerization was obtained with density functional theory calculations

Gold(I)-Initiated Cycloisomerization/Diels–Alder/Retro-Diels–Alder Cascade Strategy to Biaryls

A unique approach to biaryls was developed on the basis of propargyl vinyl ethers and dienophiles substrates via a gold­(I)-initiated cycloisomerization/Diels–Alder/retro-Diels–Alder cascade reaction. The scope and mechanism of the reaction were investigated on the basis of a series of synthetic substrates, control experiments, and DFT calculations

Asymmetric Total Synthesis of Neobraclactone C

Asymmetric total synthesis of neobraclactone C was finished for the first time using the convergent synthetic strategy in 22 steps in the longest linear sequence from known materials. The key steps include a steric hindrance/hydrogen bond dual-controlled Heck arylation of α,β-unsaturated ketone to construct hemiketal and cis-alkenyl in one step and a CeCl3-catalyzed tricycle formation