Empirical Study of the Effect of Website Information Architecture on Customer Loyalty

Website customer loyalty is believed to be very important to the success of E-Commerce firms. Based on document review, this study constructs a customer loyalty effect model which chooses organization, navigation, labeling and searching system as dependent variables as well as attitude and behavior loyalty as variables. The sample of the study was drawn from 250 students who have online shopping experience, 202 of usable questionnaires were included in the data analysis. Data analyses using correlation and regression analysis reveal that there was a strong and positive relationship between information architecture and customer loyalty. Also, organization, navigation, labeling and search systems were positively correlated with customer loyalty. The results could be a reference for designing of the E-Commerce website

N-terminal lid swapping contributes to the substrate specificity and activity of thermophilic lipase TrLipE

TrLipE is a thermophilic lipase that has potential commercial applications because of its catalytic ability under extreme conditions. Consistent with most lipases, the lid of TrLipE is located over the catalytic pocket, controls the substrate channel to the active center, and regulates the substrate specificity, activity, and stability of the enzyme through conformational changes. TrLipE from Thermomicrobium roseum has potential industrial applications, which is hindered by its weak enzymatic activity. Here, 18 chimeras (TrL1-TrL18) were reconstructed by N-terminal lid swapping between TrLipE and structurally similar enzymes. The results showed that the chimeras had a similar pH range and optimum pH as wild TrLipE but a narrower temperature range of 40–80°C, and TrL17 and the other chimeras showed lower optimum temperatures of 70°C and 60°C, respectively. In addition, the half-lives of the chimeras were lower than those of TrLipE under optimum temperature conditions. Molecular dynamics simulations indicated that chimeras had high RMSD, RMSF, and B-factor values. When p-nitrophenol esters with different chains were used as substrates, compared with TrLipE, most of the chimeras had a low Km and high kcat value. The chimeras TrL2, TrL3, TrL17, and TrL18 could specifically catalyze the substrate 4-nitrophenyl benzoate, with TrL17 showing the highest kcat/Km value of 363.88 ± 15.83 L⋅min–1⋅mmol–1. Mutants were then designed by investigating the binding free energies of TrL17 and 4-nitrophenyl benzoate. The results indicated that single, double, and triple substitution variants (M89W and I206N; E33W/I206M and M89W/I206M; and M89W/I206M/L21I and M89W/I206N/L21I, respectively) presented approximately 2- to 3-fold faster catalysis of 4-nitrophenyl benzoate than the wild TrL17. Our observations will facilitate the development of the properties and industrial applications of TrLipE

Dissecting causal relationships between immune cells, plasma metabolites, and COPD: a mediating Mendelian randomization study

ObjectiveThis study employed Mendelian Randomization (MR) to investigate the causal relationships among immune cells, COPD, and potential metabolic mediators.MethodsUtilizing summary data from genome-wide association studies, we analyzed 731 immune cell phenotypes, 1,400 plasma metabolites, and COPD. Bidirectional MR analysis was conducted to explore the causal links between immune cells and COPD, complemented by two-step mediation analysis and multivariable MR to identify potential mediating metabolites.ResultsCausal relationships were identified between 41 immune cell phenotypes and COPD, with 6 exhibiting reverse causality. Additionally, 21 metabolites were causally related to COPD. Through two-step MR and multivariable MR analyses, 8 cell phenotypes were found to have causal relationships with COPD mediated by 8 plasma metabolites (including one unidentified), with 1-methylnicotinamide levels showing the highest mediation proportion at 26.4%.ConclusionWe have identified causal relationships between 8 immune cell phenotypes and COPD, mediated by 8 metabolites. These findings contribute to the screening of individuals at high risk for COPD and offer insights into early prevention and the precocious diagnosis of Pre-COPD

Nonlinear hydro turbine model having a surge tank.

yesThis paper models a hydro turbine based on the dynamic description of the hydraulic system having a surge tank and elastic water hammer. The dynamic of the hydraulic system is transformed from transfer function form into the differential equation model in relative value. This model is then combined with the motion equation of the main servomotor to form the nonlinear model of the hydro turbine, in which the power of the hydro turbine is calculated using algebraic equation. A new control model is thus proposed in which the dynamic of the surge tank is taken as an additional input of control items. As such, the complex hydraulic system is decomposed into a classical one penstock and one machine model with an additional input control. Therefore, the order of the system is descended. As a result, the feasibility of the system is largely improved. The simulated results show that the additional input of the surge tank is effective and the proposed method is realizable.National Natural Science Foundation of China (50839003, 50949037, 51179079), Natural Science Foundation of Yunnan Province (No. 2008GA027

A Research Review on Effect of eWOM

With the development of the electronic commerce, the electronic word-of-mouth (eWOM) has become important reference information of the consumer shopping. EWOM has attracted considerable interest from researchers in the past decade. There are plenty of academics who looked into what factors play the important roles in effect of eWOM. In this paper, a research review is conducted and an integrated framework is proposed on effects of eWOM. The effects of eWOM are influenced by the characteristics, communicators, and other factors. The characteristics of eWOM include the source, the volume and the valence. The communicators of eWOM refer to the sender, the receiver and the relationship between them. In addition, dispersion and consistency, persistence and observability, anonymity and deception, and community engagement are related factors for effect of eWOM

Intelligent coal mine data warehouse modeling method

The coal mine massive data has problems such as 'data island', weak correlation, poor data quality due to lack of data management system. It is difficult to make full use of the data and provide analysis and decision-making support for coal mine intelligence. The data warehouse can meet the requirements of multi-source heterogeneous data integration in coal mine, and provide data basis for intelligent application in coal mine. By analyzing the coal mine data types, characteristics and intelligent application requirements of actual data, the intelligent coal mine data warehouse modeling method is studied. Firstly, the layered architecture of intelligent coal mine data warehouse is constructed, and the characteristics of data model of original data layer, detailed data layer, basic index layer, service data layer and public dimension layer are analyzed. Secondly, taking the data of fully mechanized working face as an example, the modeling process of data warehouse is expounded from the aspects of business data analysis, application demand analysis and layered architecture design. Thirdly, the construction method of data model in coal mine data warehouse is introduced. The original data is transformed into data warehouse dimensional model through dimension alignment, dimension association and dimensional index aggregation. The method solves the application problem of coal mine data association in different dimensions. Finally, in order to solve the problem of portability of coal mine data warehouse, the design idea of coal mine parametric data warehouse based on general data warehouse in coal mine industry + parametric ETL (extraction-transformation-load) method is proposed. The platform of coal mine data warehouse in the laboratory environment is set up to process the data of fully mechanized working face of Shanxi Tiandi Wangpo Coal Industry Co., Ltd. The auxiliary mechanism model analysis and visual management cockpit are realized based on the processing data, which verifies the practicability of intelligent coal mine data warehouse. The performance indexes of the original data model and the intelligent coal mine data warehouse are compared. The results show that the data organization, model reuse and iteration difficulty of the intelligent coal mine data warehouse are better than those of the original data model, and the data query response time is shortened by more than 50%

Attention Enhanced U-Net for Building Extraction from Farmland Based on Google and WorldView-2 Remote Sensing Images

High-resolution remote sensing images contain abundant building information and provide an important data source for extracting buildings, which is of great significance to farmland preservation. However, the types of ground features in farmland are complex, the buildings are scattered and may be obscured by clouds or vegetation, leading to problems such as a low extraction accuracy in the existing methods. In response to the above problems, this paper proposes a method of attention-enhanced U-Net for building extraction from farmland, based on Google and WorldView-2 remote sensing images. First, a Resnet unit is adopted as the infrastructure of the U-Net network encoding part, then the spatial and channel attention mechanism module is introduced between the Resnet unit and the maximum pool and the multi-scale fusion module is added to improve the U-Net network. Second, the buildings found on WorldView-2 and Google images are extracted through farmland boundary constraints. Third, boundary optimization and fusion processing are carried out for the building extraction results on the WorldView-2 and Google images. Fourth, a case experiment is performed. The method in this paper is compared with semantic segmentation models, such as FCN8, U-Net, Attention_UNet, and DeepLabv3+. The experimental results indicate that this method attains a higher accuracy and better effect in terms of building extraction within farmland; the accuracy is 97.47%, the F1 score is 85.61%, the recall rate (Recall) is 93.02%, and the intersection of union (IoU) value is 74.85%. Hence, buildings within farming areas can be effectively extracted, which is conducive to the preservation of farmland

Alleviation of Oxidative Damage and Involvement of Nrf2-ARE Pathway in Mesodopaminergic System and Hippocampus of Status Epilepticus Rats Pretreated by Intranasal Pentoxifylline

The current studies were aimed at evaluating the efficacy of intranasal pentoxifylline (Ptx) pretreatment in protecting mesodopaminergic system and hippocampus from oxidative damage of lithium-pilocarpine induced status epilepticus (SE) and the involvement of nuclear factor erythroid 2-related factor 2- (Nrf2-) antioxidant response elements pathway. Pentoxifylline was administered to rats intranasally or intraperitoneally 30 minutes before inducing SE. Our results showed the impaired visuospatial memory, the defected mesodopaminergic system, and the oxidative damage and the transient activation of Nrf2 in SE rats. The transient activation of Nrf2 in SE rats was enhanced by Ptx pretreatment, which was followed by the upregulation of heme oxygenase-1 and NAD(P)H:quinone oxidoreductase-1. Ptx pretreatment to SE rats significantly suppressed the epileptic seizures, decreased the levels of lipid peroxide and malondialdehyde, and elevated the ratio of reduced glutathione/oxidized glutathione. Compared with intraperitoneal injection, intranasal Ptx delivery completely restored the visuospatial memory and the activity of mesodopaminergic system in SE rats. Intranasal administration of Ptx may hopefully become a noninvasive, painless, and easily administered option for epileptic patients

Analysis of Xylose Operon from Paenibacillus polymyxa ATCC842 and Development of Tools for Gene Expression

With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was “ACTTAGTTTAAGCAATAGACAAAGT”, and this can be degenerated to “ACTTWGTTTAWSSNATAVACAAAGT” in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose