33 research outputs found
Alleviation of Oxidative Damage and Involvement of Nrf2-ARE Pathway in Mesodopaminergic System and Hippocampus of Status Epilepticus Rats Pretreated by Intranasal Pentoxifylline
N-terminal lid swapping contributes to the substrate specificity and activity of thermophilic lipase TrLipE
TrLipE is a thermophilic lipase that has potential commercial applications because of its catalytic ability under extreme conditions. Consistent with most lipases, the lid of TrLipE is located over the catalytic pocket, controls the substrate channel to the active center, and regulates the substrate specificity, activity, and stability of the enzyme through conformational changes. TrLipE from Thermomicrobium roseum has potential industrial applications, which is hindered by its weak enzymatic activity. Here, 18 chimeras (TrL1-TrL18) were reconstructed by N-terminal lid swapping between TrLipE and structurally similar enzymes. The results showed that the chimeras had a similar pH range and optimum pH as wild TrLipE but a narrower temperature range of 40–80°C, and TrL17 and the other chimeras showed lower optimum temperatures of 70°C and 60°C, respectively. In addition, the half-lives of the chimeras were lower than those of TrLipE under optimum temperature conditions. Molecular dynamics simulations indicated that chimeras had high RMSD, RMSF, and B-factor values. When p-nitrophenol esters with different chains were used as substrates, compared with TrLipE, most of the chimeras had a low Km and high kcat value. The chimeras TrL2, TrL3, TrL17, and TrL18 could specifically catalyze the substrate 4-nitrophenyl benzoate, with TrL17 showing the highest kcat/Km value of 363.88 ± 15.83 L⋅min–1⋅mmol–1. Mutants were then designed by investigating the binding free energies of TrL17 and 4-nitrophenyl benzoate. The results indicated that single, double, and triple substitution variants (M89W and I206N; E33W/I206M and M89W/I206M; and M89W/I206M/L21I and M89W/I206N/L21I, respectively) presented approximately 2- to 3-fold faster catalysis of 4-nitrophenyl benzoate than the wild TrL17. Our observations will facilitate the development of the properties and industrial applications of TrLipE
Nonlinear hydro turbine model having a surge tank.
yesThis paper models a hydro turbine based on the dynamic description of the hydraulic system having a surge tank and elastic water hammer. The dynamic of the hydraulic system is transformed from transfer function form into the differential equation model in relative value. This model is then combined with the motion equation of the main servomotor to form the nonlinear model of the hydro turbine, in which the power of the hydro turbine is calculated using algebraic equation. A new control model is thus proposed in which the dynamic of the surge tank is taken as an additional input of control items. As such, the complex hydraulic system is decomposed into a classical one penstock and one machine model with an additional input control. Therefore, the order of the system is descended. As a result, the feasibility of the system is largely improved. The simulated results show that the additional input of the surge tank is effective and the proposed method is realizable.National Natural Science Foundation of China (50839003, 50949037, 51179079), Natural Science Foundation of Yunnan Province (No. 2008GA027
Intelligent coal mine data warehouse modeling method
The coal mine massive data has problems such as 'data island', weak correlation, poor data quality due to lack of data management system. It is difficult to make full use of the data and provide analysis and decision-making support for coal mine intelligence. The data warehouse can meet the requirements of multi-source heterogeneous data integration in coal mine, and provide data basis for intelligent application in coal mine. By analyzing the coal mine data types, characteristics and intelligent application requirements of actual data, the intelligent coal mine data warehouse modeling method is studied. Firstly, the layered architecture of intelligent coal mine data warehouse is constructed, and the characteristics of data model of original data layer, detailed data layer, basic index layer, service data layer and public dimension layer are analyzed. Secondly, taking the data of fully mechanized working face as an example, the modeling process of data warehouse is expounded from the aspects of business data analysis, application demand analysis and layered architecture design. Thirdly, the construction method of data model in coal mine data warehouse is introduced. The original data is transformed into data warehouse dimensional model through dimension alignment, dimension association and dimensional index aggregation. The method solves the application problem of coal mine data association in different dimensions. Finally, in order to solve the problem of portability of coal mine data warehouse, the design idea of coal mine parametric data warehouse based on general data warehouse in coal mine industry + parametric ETL (extraction-transformation-load) method is proposed. The platform of coal mine data warehouse in the laboratory environment is set up to process the data of fully mechanized working face of Shanxi Tiandi Wangpo Coal Industry Co., Ltd. The auxiliary mechanism model analysis and visual management cockpit are realized based on the processing data, which verifies the practicability of intelligent coal mine data warehouse. The performance indexes of the original data model and the intelligent coal mine data warehouse are compared. The results show that the data organization, model reuse and iteration difficulty of the intelligent coal mine data warehouse are better than those of the original data model, and the data query response time is shortened by more than 50%
Alleviation of Oxidative Damage and Involvement of Nrf2-ARE Pathway in Mesodopaminergic System and Hippocampus of Status Epilepticus Rats Pretreated by Intranasal Pentoxifylline
The current studies were aimed at evaluating the efficacy of intranasal pentoxifylline (Ptx) pretreatment in protecting mesodopaminergic system and hippocampus from oxidative damage of lithium-pilocarpine induced status epilepticus (SE) and the involvement of nuclear factor erythroid 2-related factor 2- (Nrf2-) antioxidant response elements pathway. Pentoxifylline was administered to rats intranasally or intraperitoneally 30 minutes before inducing SE. Our results showed the impaired visuospatial memory, the defected mesodopaminergic system, and the oxidative damage and the transient activation of Nrf2 in SE rats. The transient activation of Nrf2 in SE rats was enhanced by Ptx pretreatment, which was followed by the upregulation of heme oxygenase-1 and NAD(P)H:quinone oxidoreductase-1. Ptx pretreatment to SE rats significantly suppressed the epileptic seizures, decreased the levels of lipid peroxide and malondialdehyde, and elevated the ratio of reduced glutathione/oxidized glutathione. Compared with intraperitoneal injection, intranasal Ptx delivery completely restored the visuospatial memory and the activity of mesodopaminergic system in SE rats. Intranasal administration of Ptx may hopefully become a noninvasive, painless, and easily administered option for epileptic patients
Analysis of Xylose Operon from Paenibacillus polymyxa ATCC842 and Development of Tools for Gene Expression
With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was “ACTTAGTTTAAGCAATAGACAAAGT”, and this can be degenerated to “ACTTWGTTTAWSSNATAVACAAAGT” in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose
Leukemic marrow infiltration reveals a novel role for Egr3 as a potent inhibitor of normal hematopoietic stem cell proliferation
Cytopenias resulting from the impaired generation of normal blood cells from hematopoietic precursors are important contributors to morbidity and mortality in patients with leukemia. However, the process by which normal hematopoietic cells are overtaken by emerging leukemia cells and how different subsets of hematopoietic stem cells (HSCs) and hematopoietic progenitor cells (HPCs) are distinctly influenced during leukemic cell infiltration is poorly understood. To investigate these important questions, we used a robust nonirradiated mouse model of human MLL-AF9 leukemia to examine the suppression of HSCs and HPCs during leukemia cell expansion in vivo. Among all the hematopoietic subsets, long-term repopulating HSCs were the least reduced, whereas megakaryocytic-erythroid progenitors were the most significantly suppressed. Notably, nearly all of the HSCs were forced into a noncycling state in leukemic marrow at late stages, but their reconstitution potential appeared to be intact upon transplantation into nonleukemic hosts. Gene expression profiling and further functional validation revealed that Egr3 was a strong limiting factor for the proliferative potential of HSCs. Therefore, this study provides not only a molecular basis for the more tightened quiescence of HSCs in leukemia, but also a novel approach for defining functional regulators of HSCs in disease