Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia

Background and Aim: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs. Materials and Methods: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5'CATGGGGACGAGGACTATACTATG '3 and reverse primer: 5'GTAGTCCCAATGTAAGGGATAGCTG'3. Results: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs. Conclusion: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia

VASEKTOMI DAN PEMOTONGAN TARING MONYET EKOR PANJANG (Macaca fascicularis) DI LOKASI WISATA ULUWATU

Population growth and aggressiveness are important factors on macaque populations in which their habitats are used as tourist destinations. Controlling those two factors may decrease the negative impact of population both to its surrounding environment and to the internal circumstance of population. This Community Service was packed as a vasectomy and canine cutting services on the adult male of long tailed macaques occupying a tourist destination of Uluwatu, Badung Regency. Vasectomy is a surgical division of all or part of vas deferens to induce sterility. Surgical resection of part of vas deferens used a bilateral slicing method. Additional medical treatments were also performed according to cases encountered in field. During this performance, one selected adult male was vasectomy-surged and four adult males subjected to canine cutting. An operation of removing rubber encircling the neck of a juvenile macaque was done successfully. Moreover, uprooting snare tied the left leg (near tarsal region) of sub adult male was also performed successfully. A week later, Uluwatu manajement reported that all individuals formerly subjected to medical treatments were in good health and their wounds went to be healing completely

VASEKTOMI PADA MONYET EKOR PANJANG (MACACA FASCICULARIS)DI LOKASI WISATA SANGEH

ABSTRACT Growth population control on the animal population dwelling a restricted habitat is very important to decrease, especially the negative impact on its surrounding environment. This Community Service was conducted as an application of vasectomy on an adult male of long tailed macaque occupying the tourist destination of Sangeh. This was the choosen method to overcome the overcrowded population. Vasectomy is surgical division of all or part of the vas deferens to induce sterility. One selected adult male monkey was anesthetized successfully using blowpipe. Surgical resection of part of vas deferens used a bilateral slicing method. Vasectomy was fully done nearly in one hour, and the monkey was released to habitat in the following three days of captivity. </em

Inferring functional patterns of tool use behavior from the temporal structure of object play sequences in a non-human primate species

Inferring functional components of behavioral sequences is a crucial but challenging task. A systematic comparison of their temporal structure is a good starting point, based on the postulate that more functional traits are less structurally variable. We studied stone handling behavior (SH) in Balinese long-tailed macaques, a versatile form of stone-directed play. We tested the hypothesis that stones are used by male monkeys to stimulate their genitals in a sexual context (i.e., “sex toy” hypothesis). Specifically, two SH actions (i.e., “tap-on-groin” (TOG) and “rub-on-groin” (ROG), respectively the repetitive tapping and rubbing of a stone onto the genital area) gained functional properties as self-directed tool-assisted masturbation. Owing to the structural organization of playful activities, we predicted that SH sequences without TOG/ROG would exhibit higher levels of variability, repeatability and exaggeration than SH sequences with TOG/ROG. We also predicted that TOG/ROG would occur more often and last longer in SH sequences in which penile erection – a sexually-motivated physiological response in primates – was observed than in SH sequences in which penile erection was not observed. To identify and compare recurring series of SH patterns otherwise undetectable by using conventional quantitative approaches across SH sequences containing TOG/ROG or not, we used a temporal analysis known as “T-pattern detection and analysis” (TPA). Our predictions about variability, exaggeration and temporal association between TOG/ROG in males and penile erection were supported. As expected, SH sequences without TOG/ROG were, on average, more repeatable than SH sequences with TOG/ROG, but the difference was not statistically significant. Overall, the “sex toy” hypothesis was partly supported, and our results suggested that TOG and ROG are two forms of tool-assisted genital stimulation, possibly derived from the playful handling of stones. These findings are consistent with the view that tool use may evolve in stages from initially non-functional object manipulation, such as object play

Behavior Systems Approach to Object Play: Stone Handling Repertoire as a Measure of Propensity for Complex Foraging and Percussive Tool Use in the Genus Macaca

Stone handling (SH), has been identified in four closely related primate species of the Macaca genus. We provide the first ethogram of SH in long-tailed macaques (Macaca fascicularis), a primate species known to use stones for extractive foraging. A total of 62.7 hrs of video recorded data were scored from a population of Balinese long-tailed macaques living in Ubud, Bali, Indonesia, and a total of 36 stone handling patterns were identified. Behavior discovery curves were generated and showed that the minimum threshold of completeness was exceeded for the SH repertoire in this group. A “foraging substitute” hypothesis for the expression of SH was proposed, suggesting that SH consists of performing foraging-like actions on non-edible objects. We used a “behavior systems” framework to test this prediction, finding that all 36 stone handling patterns could be reliably categorized in a foraging behavior system, supporting the hypothesis that stone handling can be considered pseudo-foraging behavior. Our “behavior systems” approach will serve as a foundation for the future testing of the motivational basis of stone handling. Additionally, a comparison of 39 stone handling patterns performed by three macaque species (M. fascicularis, M. fuscata and M. mulatta) showed overlapping behavioral propensities to manipulate stones; however, the differences suggest that long-tailed macaques might be more prone to use stones as percussive tools in a foraging context. This work could offer insights into the development and evolution of complex activities such as percussive stone tool use in early humans