Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter

Transcription of the prostate-specific antigen (PSA) gene is androgen regulated. The PSA promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR are involved in dexamethasone regulation of the PSA promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity

An androgen response element in a far upstream enhancer region is essential for high, androgen-regulated activity of the prostate-specific antigen promoter

Prostate-specific antigen (PSA) is expressed at a high level in the luminal epithelial cells of the prostate and is absent or expressed at very low levels in other tissues. PSA expression can be regulated by androgens. Previously, two functional androgenresponse elements were identified in the proximal promoter of the PSA gene. To detect additional, more distal control elements, DNaseI-hypersensitive sites (DHSs) upstream of the PSA gene were mapped in chromatin from the prostate-derived cell line LNCaP grown in the presence and absence of the synthetic androgen R1881. In a region 4.8 to 3.8 kb upstream of the transcription start site of the PSA gene, a cluster of three DHSs was detected. The middle DNAseI-hypersensitive site (DHSII, at ;24.2 kb) showed strong androgen responsiveness in LNCaP cells and was absent in chromatin from HeLa cells. Further analysis of the region encompassing DHSII provided evidence for the presence of a complex, androgen-responsive and cellspecific enhancer. In transient transfected LNCaP cells, PSA promoter constructs containing this upstream enhancer region showed approximately 3000-fold higher activity in the presence than in the absence of R1881. The core region of the enhancer could be mapped within a 440-bp fragment. The enhancer showed synergistic cooperation with the proximal PSA promoter and was found to be composed of at least three separate regulatory regions. In the center, a functionally active, high-affinity androgen receptor binding site (GGAACATATTGTATC) could be identified. Mutation of this element almost completely abolished PSA promoter activity. Transfection experiments in prostate and nonprostate cell lines showed largely LNCaP cell specificity of the upstream enhancer region, although some activity was found in the T47D mammary tumor cell line

Both androgen receptor and glucocorticoid receptor are able to induce prostate-specific antigen expression, but differ in their growth-stimulating properties of LNCaP cells

Androgen receptor-positive LNCaP cells were stably transfected with a rat glucocorticoid receptor (GR) expression plasmid. Ligand-binding studies in the generated cell lines revealed high-affinity binding of the cognate ligands to their receptors. Transfection experiments with the newly derived cell lines showed that, like androgen receptor, GR can induce activity of a prostate-specific antigen promoter fragment linked to the luciferase gene. Similarly, dexamethasone can stimulate expression of endogenous prostate-specific antigen messenger RNA. Cell proliferation could be induced by R1881. In contrast, dexamethasone treatment of the GR-positive sublines had no stimulatory effect on cell growth. Using the differential display technique, a so far unknown complementary DNA fragment, designated 21.1, specifically induced by androgens and not by glucocorticoids, has been identified. In conclusion, the newly generated cell lines, together with the parental LNCaP cell line, form an attractive system with which to study the mechanism of specificity of steroid hormone regulation of gene expression

A 6-kb promoter fragment mimics in transgenic mice the prostate-specific and androgen-regulated expression of the endogenous prostate-specific antigen gene in humans

Prostate-specific antigen (PSA) is a kallikrein-like serine protease, which is almost exclusively synthesized in the luminal epithelial cells of the human prostate. PSA expression is androgen regulated. Previously, we characterized in vitro the proximal promoter, and a strong enhancer region, approximately 4 kb upstream of the PSA gene. Both regions are needed for high, androgen-regulated activity of the PSA promoter in LNCaP cells. The goal of the present study is the in vivo characterization of the PSA promoter. Three transgenic mouse lines carrying the Escherichia coli LacZ gene, driven by the 632-bp proximal PSA promoter, and three lines with LacZ, driven by the 6-kb PSA promoter, were generated. Expression of the LacZ reporter gene was analyzed in a large series of tissues. Transgene expression could not be demonstrated in any of the transgenic animals carrying the proximal PSA promoter. All three lines carrying the 6-kb PSA promoter showed lateral prostate-specific beta-galactosidase activity. Transgene expression was undetectable until 8 weeks after birth. Upon castration, beta-galactosidase activity rapidly declined. It could be restored by subsequent androgen administration. A search for mouse PSA-related kallikrein genes expressed in the prostate led to the identification of mGK22, which was previously demonstrated to be expressed in the submandibular salivary gland. Therefore, the 6-kb PSA-LacZ transgene followed the expression pattern of the PSA gene in humans, which is almost completely prostate-specific, rather than that of mGK22 in mice. In conclusion, the 6-kb promoter fragment appears to contain most, if not all, information for androgen regulation and prostate specificity of the PSA gene

Variation of prostate-specific antigen expression in different tumour growth patterns present in prostatectomy specimens

A series of 55 randomly chosen radical prostatectomy specimens was analyzed for expression of prostate-specific antigen (PSA) by immunohistochemical techniques. Tissue sections were selected in such a manner that in addition to glandular benign prostatic hyperplasia (BPH), one or more different prostatic tumour growth patterns were present. Four monoclonal antibodies, directed against three different PSA epitopes, and one polyclonal anti-PSA antiserum were used. Expression of PSA was compared with that of prostate-specific acid phosphatase (PAP), recognized by two different polyclonal antisera. A critical dilution aimed at a maximum of staining intensity on BPH tissue sections was chosen for all antibodies. Anti-PSA and anti-PAP antisera stained essentially all BPH samples (over 90%). Irrespective of the nature of the antibodies used, PSA expression was found to be decreased in prostatic carcinoma. A clear cut relationship was found between immunoreactivity for PSA and the degree of differentiation of the tumour area. Under the experimental conditions used the PSA monoclonal antibodies stained only 1 out of 10 undifferentiated carcinomas, whereas 50% to 70% of the well- and moderately-differentiated carcinomas showed immunoreactivity. This correlation was less pronounced with the PAP staining pattern. If the PSA antibody titer was raised the percentage of clearly staining undifferentiated carcinomas could be considerably increased (up to 60%-100%), indicating that PSA expression is not absent, but lowered in most (if not all) undifferentiated carcinomas

A mononucleotide repeat in PRRT2 is an important, frequent target of mismatch repair deficiency in cancer

The DNA mismatch repair (MMR) system corrects DNA replication mismatches thereby contributing to the maintenance of genomic stability. MMR deficiency has been observed in prostate cancer but its impact on the genomic landscape of these tumours is not known. In order to identify MMR associated mutations in prostate cancer we have performed whole genome sequencing of the MMR deficient PC346C prostate cancer cell line. We detected a total of 1196 mutations in PC346C which was 1.5-fold higher compared to a MMR proficient prostate cancer sample (G089). Of all different mutation classes, frameshifts in mononucleotide repeat (MNR) sequences were significantly enriched in the PC346C sample. As a result, a selection of genes with frameshift mutations in MNR was further assessed regarding its mutational status in a comprehensive panel of prostate, ovarian, endometrial and colorectal cancer cell lines. We identified PRRT2 and DAB2IP to be frequently mutated in MMR deficient cell lines, colorectal and endometrial cancer patient samples. Further characterization of PRRT2 revealed an important role of this gene in cancer biology. Both normal prostate cell lines and a colorectal cancer cell line showed increased proliferation, migration and invasion when expressing the mutated form of PRRT2 (ΔPRRT2). The wild-type PRRT2 (PRRT2wt) had an inhibitory effect in proliferation, consistent with the low expression level of PRRT2 in cancer versus normal prostate samples

Androgen receptor mutations

Male sexual differentiation and development proceed under direct control of androgens. Androgen action is mediated by the intracellular androgen receptor, which belongs to the superfamily of ligand-dependent transcription factors. At least three pathological situations are associated with abnormal androgen receptor structure and function: androgen insensitivity syndrome (AIS), spinal and bulbar muscular atrophy (SBMA) and prostate cancer. In the X-linked androgen insensitivity syndrome, defects in the androgen receptor gene have prevented the normal development of both internal and external male structures in 46,XY individuals. Complete or gross deletions of the androgen receptor gene have not been found frequently in persons with complete androgen insensitivity syndrome. Point mutations at several different sites in exons 2–8 encoding the DNA- and androgen-binding domain, have been reported for partial and complete forms of androgen insensitivity. A relatively high number of mutations were reported in two different clusters in exon 5 and in exon 7. The number of mutations in exon 1 is extremely low and no mutations have been reported in the hinge region, located between the DNA-binding domain and the ligand-binding domain and which is encoded by the first half of exon 4. Androgen receptor gene mutations in prostate cancer are very rare and are reported only in exons 4–8. The X-linked spinal and bulbar muscle atrophy (SBMA; Kennedy's disease) is associated with an expanded length (> 40 residues) of one of the polyglutamine stretches in the N-terminal domain of the androgen receptor

De vele beelden van integraal werken:rapport van het onderzoeksproject Integraal aan het werk

Veel gemeenten hebben vanuit de transities gekozen om de ondersteuning voor inwoners zo integraal mogelijk te organiseren. Dit betekent dat gekeken wordt naar meerdere leefgebieden om te voorkomen dat inwoners aan te veel instanties steeds weer hun verhaal moeten doen om de benodigde ondersteuning te kunnen krijgen. Twee jaar geleden constateerde de Inspectie van het ministerie van SZW (2016) dat er geen duidelijke definitie is van het begrip integrale dienstverlening. Er kan vanuit beleidsperspectief worden gekeken, vanuit organisatieperspectief, uitvoeringsperspectief, maar ook vanuit het perspectief van de klant. Elk perspectief kent zijn eigen betekenis toe aan integraal werken, roept zijn eigen beelden op. Dit maakt het gesprek erover lastig. De opdracht van dit onderzoek was het uitvoeren van een kennissynthese: het bij elkaar brengen van verschillende typen kennis (wetenschappelijke kennis, praktijkkennis en klantenkennis), niet alleen om de betrouwbaarheid en validiteit van die kennis te vergroten maar vooral de toepasbaarheid. Daartoe hebben we de beelden en betekenissen van de centrale partijen, klanten, sociale professionals en klantmanagers, over integraal werk en de werkzame bestanddelen ervan onderzocht en deze samengebracht met hetgeen in de literatuur hierover bekend is. De onderzoeksvragen luiden: • Wat verstaan klanten, sociale professionals en klantmanagers Werk en Inkomen onder integrale dienstverlening? • Wat zijn volgens klanten, sociale professionals en klantmanagers Werk en Inkomen werkzame en effectieve principes van integrale dienstverlening? • Welke onderbouwing in de wetenschappelijke literatuur is er voor de door de klanten, sociale professionals en klantmanagers Werk en Inkomen geformuleerde werkzame en effectieve principes van integrale dienstverlening