An Investigation of the Relationship between Cyniclomyces guttulatus and Rabbit Diarrhoea

Cyniclomyces guttulatus is usually recognised as an inhabitant of the gastrointestinal (GI) tract in rabbits. However, large numbers of C. guttulatus are often detected in the faeces of diarrhoeic rabbits. The relationship of C. guttulatus with rabbit diarrhoea needs to be clearly identified. In this study, a C. guttulatus Zhejiang strain was isolated from a New Zealand White rabbit with severe diarrhoea and then inoculated into SPF New Zealand white rabbits alone or co-inoculated with Eimeriaintestinalis, another kind of pathogen in rabbits. Our results showed that the optimal culture medium pH and temperature for this yeast were pH 4.5 and 40–42 °C, respectively. The sequence lengths of the 18S and 26S ribosomal DNA fragments were 1559 bp and 632 bp, respectively, and showed 99.8% homology with the 18S ribosomal sequence of the NRRL Y-17561 isolate from dogs and 100% homology with the 26S ribosomal sequence of DPA-CGR1 and CGDPA-GP1 isolates from rabbits and guinea pigs, respectively. In animal experiments, the C. guttulatus Zhejiang strain was not pathogenic to healthy rabbits, even when 1 × 108 vegetative cells were used per rabbit. Surprisingly, rabbits inoculated with yeast showed a slightly better body weight gain and higher food intake. However, SPF rabbits co-inoculated with C. guttulatus and E. intestinalis developed more severe coccidiosis than rabbits inoculated with C. guttulatus or E. intestinalis alone. In addition, we surveyed the prevalence of C. guttulatus in rabbits and found that the positive rate was 83% in Zhejiang Province. In summary, the results indicated that C. guttulatus alone is not pathogenic to healthy rabbits, although might be an opportunistic pathogen when the digestive tract is damaged by other pathogens, such as coccidia

Transcriptome Analysis Reveals the Molecular Mechanism of Resting Cyst Formation in Colpoda aspera

Resting cyst formation is a remarkable survival strategy used by ciliates in response to the adverse environmental conditions. However, the mechanisms underlying encystment are poorly understood. Here, the genetic basis of encystment in Colpoda aspera was examined through RNA sequencing to identify transcriptome-wide changes in gene expression between vegetative and encystment stages. After de novo assembly, 49,543 transcripts were identified. Gene annotation and pathway mapping analysis revealed marked changes in biosynthesis, energy metabolism, and autophagy pathways during cyst formation. In addition, some differentially regulated genes were predicted to function in the interconnected cAMP, AMPK, mTOR, and PI3K/AKT signaling pathways, potentially forming a regulatory network for encystment. The present study conducted a large-scale assessment of Colpoda aspera genomic resources and provides new insight into the molecular mechanisms underlying cyst formation

Pathogenicity and drug resistance of the Eimeria tenella isolate from Yiwu, Zhejiang province, eastern China

ABSTRACT: Chicken coccidiosis can cause severe enteritis with high mortality, which causes serious economic losses to the global breeding industry each year. The most virulent species is Eimeria tenella (E. tenella), but the infectivity of different E. tenella varies among geographic strains. At present, there are no reports related to the pathogenicity and drug resistance of E. tenella in Yiwu, Zhejiang province, China. A total of 600 fecal samples were collected from 10 farms in Zhejiang province, the overall oocyst prevalence was 54.2% (325/600). The prevalence was significantly higher (P < 0.01) in chickens under 40 d (97.5%) than that in chickens between 60 and 85-days-old (40.5%) and chickens over 90-days-old (24.5%). E. tenella stain was isolated from fecal samples of chickens in Yiwu and the pathogenicity of this isolate was determined, and then we recorded the survival rate, bloody stool score, lesion score, average weight gain. The results showed that all of the chickens infected with 5 × 105 sporulated oocysts of E. tenella died after the seventh day of infection, the bloody stool score and average lesion score of chickens from group 1 (5 × 105), group 2 (5 × 104), group 3 (5 × 103) and group 4 (5 × 102) decreased successively; the average weight gain (g) and relative weight gain (%) increased successively; the weight gain of the low-dose E. tenella infection groups (5 × 103 and 5 × 102) were higher than the other 2 groups (5 × 105 and 5 × 104) (P < 0.05). Finally, The E. tenella isolate was tested for sensitivity to 6 anticoccidial drugs (sulfachloropyrazine sodium, amproline, toltrazuril, clopidol, salinomycin, and nicarbazine) using 4 indexes including anticoccidial index(ACI), percent of optimum anticoccidial activity (POAA), reduction of lesion scores (RLS), and relative oocyst production (ROP). The results showed that this isolate has developed severe resistance to drugs of salinomycin and nicarbazine, moderate resistance to amproline and clopidol, slight resistance to toltrazuril, while the E. tenella isolate performed more sensitive to sulfachloropyrazine sodium

Isolation of fluorescent oocysts by FACS.

<p>(A) The percentage of fluorescent oocysts increased from 0.01% in the first generation to 48.5% in the fourth generation. (B) EYFP-expressing oocysts (48.5%) from the fourth generation.</p

Transgenic fluorescent <i>Eimeria tenella</i> parasites.

<p>Sporozoite (A), early stage (B) and mature (C) first generation schizonts expressed EYFP predominantly in the parasite nuclei following transfection with the helper plasmid pH 4-IFP2-A and the donor plasmid pHEA-Bac. Late generation merozoite (D) and schizont (E), unsporulated (F) and sporulated (G) oocysts also presented fluorescent nuclei following transfection with pH 4-IFP2-A and pHEA-Bac. In the transfection efficient assays (H), fluorescent parasites in each well (3 wells per group) were counted at 36 h post transfection. The mean and standard deviations were analysed by the Student <i>t</i> test using the SPSS 13.0 software. The significance level was set at 0.05.</p

<i>piggyBac</i> transposon plasmids designed for transfection of <i>Eimeria tenella</i>.

<p>(A) The helper plasmid pH 4-IFP2-A. (B) The donor plasmid pHEA-Bac.</p

Confirmation of exogenous gene insertion.

<p>(A) Southern-blot hybridization using the EYFP gene as the probe. Lanes 1 and 2: transgenic and wild type <i>Eimeria tenella</i> genomic DNA, lane 3: donor plasmid pHEA-Bac (presenting EYFP as a positive control). (B) Southern-blot hybridization using the transposase gene as the probe. Lane 1: transgenic <i>E.tenella</i> genomic DNA, lane2: wild type <i>E.tenella</i> genomic DNA, lane 3: helper plasmid pH 4-IFP2-A (presenting transposase gene as a positive control). (C) PCR for confirmation of insertion of part of pHEA-Bac. The expression cassette “HEA” was only amplified from transgenic parasite genomic DNA and the 3′ and 5′ plasmid flanking sequences lying outside of the ITR sequences in pHEA-Bac were not detected. Lanes including “3′P”, “5′P” and “HEAP” represented positive controls (Amplicons from the plasmid pHEA-Bac).</p

Identification of genomic sequences flanking the piggyBac insertion sites in <i>Eimeria tenella</i>.

a<p>Conservative sequence 1 (CS1):</p><p>GTAATACGACTCACTATAGGGCGAATTGAAGCTGCCCTTTGGTGCAGATGAACTTCAGGGT.</p>b<p>Conservative sequence 2 (CS2):</p><p>GAGGCGGAGTGTCCGCTGTTGCTGTGGGCAGAAAGAGGGCGGCGTAGAGAGGCATTTAGTG.</p>c<p>R2 flanking region was revealed as an AT-rich DNA sequence.</p>d<p>R5 flanking region presented in the form of tandem repeat sequences.</p