15 research outputs found
Religion and state : in Rawlsian political liberalism and some contemporary Iranian religious reformists
In the United States, there is a lively debate on the relationship between religion and politics. The separation of Church and State is the assumption of most liberal thinkers. From their perspective, such separation not only protects the State from religion, but also protects religion from the State. The first part of the present research will examine the contemporary liberal debate on religion and politics, which is based on Rawls' version of political liberalism and its critics. The second part will explore three religious discourses: the traditional, ideological and democratic discourses in contemporary Islam (in the case of Iran) with particular emphasis on the democratic discourse. This paper will also demonstrate important similarities that exist between the essential claims and arguments of some contemporary Iranian religious reformists and some liberal thinkers. It comes to the conclusion that Rawlsian political liberalism has no conflict with religious ideas, but provides an ideal environment to flourish religious values in a pluralistic society. Also, it will show that Iranian Islamic reformists, in contrast to their portrayal by some researchers as opposing Western liberal democracy, endorse Rawlsian political liberalism and support it with an Islamic interpretation of life
Cardiovascular Complications of Acute Amphetamine Abuse : Cross-sectional study
Objectives: This study aimed to evaluate cardiovascular complications among patients who abuse amphetamines. Methods: This cross-sectional study took place between April 2014 and April 2015 among 3,870 patients referred to the Toxicology Emergency Department of Baharlou Hospital, Tehran University of Medical Sciences, Tehran, Iran. Those with clinical signs of drug abuse and positive urine screening tests were included in the study, while cases of chronic abuse were excluded. Cardiac complications were evaluated via electrocardiography (ECG) and transthoracic echocardiography. Results: A total of 230 patients (5.9%) had a history of acute amphetamine abuse and positive urine tests. Of these, 32 patients (13.9%) were <20 years old and 196 (85.2%) were male. In total, 119 (51.7%) used amphetamine and methamphetamine compounds while 111 (48.3%) used amphetamines with morphine or benzodiazepines. The most common ECG finding was sinus tachycardia (43.0%), followed by sinus tachycardia plus a prolonged QT interval (34.3%). Mean creatine kinase-MB and troponin I levels were 35.9 ± 4.3 U/mL and 0.6 ± 0.2 ng/mL, respectively. A total of 60 patients (26.1%) were admitted to the Intensive Care Unit. The majority (83.3%) of these patients had normal echocardiography results. The mean aortic root diameter (ARD) was 27.2 ± 2.8 mm. Abnormalities related to the ARD were found in 10 patients (16.7%), three of whom subsequently died. Conclusion: According to these findings, cardiac complications were common among Iranian patients who abuse amphetamines, although the majority of patients had normal echocardiography and ECG findings
Understanding the Elderly’s View of Central Human Functional Capabilities
Introduction: Older people are more vulnerable to physical disability, as well as mental illnesses. They also may experience challenges that can be related to Nussbaum's Central Human Functional Capabilities. The purpose of this study was to explore the elderly's views related to Central Human Functional Capabilities.
Methods: This study used a qualitative approach to understand older people's perspectives on capabilities. Purposive sampling was used to select nineteen older women aged 65 to 79 years. The data collected through semi-structured interviews were thematically analyzed.
Results: Eighteen themes emerged by thematic analysis of the ten functional capabilities, including life (life expectancy, life satisfaction), bodily health (functional independence, nutrition, and accessibility), bodily integrity (independent decision-making and dealing with insults), senses, imagination and thought (material interests and religious beliefs), emotions (love of children),  practical reason (daily routine), affiliation (respect for others, empathy for others, gender discrimination), other species (interest in nature and flowers), play (interest in recreational activities), and control over one's environment (political participation, being dependent).
Conclusion: Despite the importance of all the capabilities from the viewpoint of the elderly, the "bodily health" and "bodily integrity" capabilities were of particular importance. Health policymakers should recognize the Central Human Functional Capabilities and allocate resources and services that best promote these capabilities for the elderly
Effectiveness of Cognitive Orientation to Daily Occupational Performance in Parkinson’s Disease: A Case Report
Introduction: Parkinson’s disease is a chronic progressive neurodegenerative disorder causing impaired motor function and various non-motor symptoms. One of the most common problems in Parkinson’s patients is occupational performance problems. The cognitive orientation to daily occupational performance (CO-OP) is one of the client-centered and problem-solving approaches in occupational therapy evaluations and interventions. This study aims to determine the effectiveness of the CO-OP approach on perceived satisfaction and occupational performance in a 62-year-old woman with Parkinson’s disease.
Case Description: The client was a 62-year-old woman with moderate cognitive impairment, stage 3 on the Hoehn and Yahr scale, and signs of depression. In our case study, the outcome measures were the Canadian occupational performance measure (COPM), functional independence measure (FIM), Montreal cognitive assessment (MOCA), and Beck depression inventory-II (BDI-II). We administered the CO-OP intervention for six weeks. Sessions were performed twice a week for one hour per session.
Results: The results indicate that the CO-OP intervention improves the client’s satisfaction, occupational performance, and functional independence. Although the results from this single case cannot be generalized, the findings suggest that CO-OP intervention may help improve satisfaction and occupational performance in adults with Parkinson’s disease. Further investigation is necessary.
Conclusion: These results suggest that CO-OP can be a valuable occupational therapy interventions for individuals with Parkinson’s disease. We recommend that occupational therapists consider using this approach in their practice to improve the occupational performance of their patients with Parkinson’s disease
Exploring occupational therapists’ views about Nussbaum’s central human functional capabilities : an exploratory sequential mixed methods study
BACKGROUND: The 21st century marks a shift in the perspective of care of people with disabilities with greater attention to individual human rights. An innovative approach related to human rights that provides a basis for conceptualizing and framing the rights of people with disabilities, is the Capability or Capabilities Approach. Developed by Sen and extended by Nussbaum, the approach advocates that fundamental human rights can be viewed as claims to certain basic capabilities. Nussbaum has proffered ten so-called Central Human Functional Capabilities (CHFCs).
OBJECTIVE: To explore the views of Canadian occupational therapists (OTs) related to the CHFCs and their understanding and perceived relevance, with respect to their professional practice.
METHODS: An exploratory sequential mixed methods design including an initial qualitative phase that informed a subsequent quantitative phase. Phase One consisted of semi-structured interviews with OTs (n=14) in British Columbia, Canada. The findings from Phase One generated 11 categories with 22 themes and 75 sub-themes. These findings informed the development of a questionnaire to survey Canadian OTs, nationally. A cross-sectional survey, registered with the Canadian Association of Occupational Therapists was conducted in Phase Two to determine the applicability of Phase One findings about the CHFCs to a broader group of OTs from across Canada. The survey was hosted at the website Fluid Surveys®. We sampled 780 OTs with a response of 109 (14%).
RESULTS: Respondents understood the CHFCs as reflecting occupational therapy values. They perceived the CHFCs as relevant and consistent with established models of and approaches to occupational therapy practice including professionally-valued constructs of human rights and social justice as well as health and client-centered care.
CONCLUSION: These findings unify and advance the conceptual bases for occupational therapy models and approaches by enabling OTs to better fulfill their professional mandate of addressing their clients’ needs from an overarching human rights perspective. Importantly, these results align occupational therapy services with client-centered practice, and human rights initiatives of the United Nations and World Health Organization. Our findings could be used by other health professions and across cultures to establish whether the Capabilities Approach is applicable across professional practices and health services.Medicine, Faculty ofGraduat
Relationship between sleep quality and spiritual well-being/religious activities in Muslim women with breast cancer
For determining relationship between quality of sleep and spiritual well-being/religious activities in Muslim women with breast cancer (WBC), we conducted a cross-sectional study on 80 WBC who presented at all chemotherapy clinics in Qom, Iran, in 2012. We used Pittsburgh Sleep Quality Index (PSQI), spiritual well-being scale (SWBS), and religious activities (RA) questionnaire. Global PSQI score and its seven components score were not significantly correlated with total score of SWBS and its two subscales. Global PSQI score was not significantly correlated with total score of RA questionnaire (P = 0.278), but its "sleep latency" (r = 0.235, P = 0.044) and "use of sleep medications" (r = 0.237, P = 0.040) components were significantly correlated with total score of RA. Global PSQI was significantly correlated with "I don't get much personal strength and support from my God," "I believe there is some real purpose for my life" questions in SWBS, and "Attendance in mosque or religious places" subscale of RA
Specifying the Concept of Sadness in the Holy Qur’an: A Qualitative Analysis
ntroduction: Sadness is the most important natural emotion of human beings. The feeling of sadness is experienced throughout the private and public life of mankind. Therefore, the present study aimed to explain the concept of grief by referring to the Holy Qur’an. Methods: This study was conducted through qualitative content analysis method. From among the Qur’anic concepts relevant to sadness, which were collected from the whole Qur’an, 60 concepts were selected via targeted sampling for analysis. Results: From the analysis of the Qur’anic concepts of sadness, six main categories including “physiology”, “psychology”, “emotion”, “spirituality”, “remedy”, and “consequences” emerged. Conclusion: According to the results, it can be inferred that sadness in the Holy Qur’an is a multidimensional concept and various structures have been used to explain it. That is why all human beings, with respect to the high incidence of depression and sadness, have to pay more attention to this concept, and for being treated, they must accept that all things in the universe occur under God’s lordship
Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens
Abstract Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection
Aptamer-based diagnosis of various SARS-CoV2 strains isolated from clinical specimens
The emergence of the SARS-CoV-2 virus, an unknown strain of coronavirus, has resulted in severe acute respiratory syndrome with high mortality rates worldwide. Due to the possibility of asymptomatic carriers, late diagnosis of infected individuals can lead to uncontrollable transmission of the disease, making early and accurate detection crucial in controlling the spread of the virus. In this study we identified high-binding-affinity aptamers targeting various strains of the SARS-CoV2 (COVID-19) virus, using the GO-Cell-SELEX (Graphene Oxide- Systematic Evolution of Ligands by Exponential Enrichment) strategy. A total of 96 aptamers were developed through 11 rounds of GO-Cell-SELEX from a random 40 nucleotide single-strand DNA (ssDNA) aptamer library. Using the surface plasmon resonance (SPR) method, the dissociation constant (Kd) values of all aptamers were calculated and two aptamers 52 and 91 with Kd 50 and 61 were selected for enzyme-linked apta-sorbent assay (ELASA). Aptamer 91 could detect various strains of the virus in above 97% of clinical samples obtained from nasopharyngeal swaps (NPS) specimens kept in viral transport media (VTM), confirmed by real-time PCR assay at COVID-19 Reference Diagnostic Laboratory of Iran, Pasture Institute. Aptamer 52 could detect the SARS-CoV2 virus in a competitive lateral flow assay (LFA) to be considered for a future designed kit. These two simple, specific, and sensitive tests can be used in combination for rapid and early diagnosis of various strains of the COVID-19 virus. Our results suggest that these two discovered aptamers present an opportunity for developing a new rapid aptamer-based coronavirus diagnostic kit
National survey of availability of physical rehabilitation services in Iran: A mixed methods study
Background: The prevalence of disability in Iran has increased due to ageing of the population and the presence
of chronic diseases. However, little is known about the availability of rehabilitation services in Iran.
Objective: To study the availability of physical rehabilitation services in Iran.
Methods: This was a mixed method study. In the first phase, a qualitative design was conducted for designing an
instrument with focus groups based on Service Availability and Readiness Assessment (SARA) instrument
(developed by World Health Organization). Content analysis was used for data analysis. Then, in the second
phase, a cross-sectional study was performed to collect the data with census method in Iran. This study was
formed from June to October 2015, and samples consisted of all governmental, public non-governmental and
private facilities established for rehabilitation centers affiliated with the Ministry of Health and Medical
Education, Ministry of Labor, Cooperative and Social Welfare and the Iranian Red Crescent Society. Data
analyses were performed using SPSS software (version 16). Descriptive statistical analysis (percentage and
frequency) were calculated for quantitative data.
Results: In the first phase, the content analysis of qualitative data identified a Master Facilities List (MFL) of
rehabilitation services and service providers in Iran. Results of the second phase showed that the rate of inpatient,
outpatient, community-based and long-term care centers per 1,000,000 populations in Iran were 1.68, 89.24,
66.21 and 3.6, respectively. Also, that the rate of rehabilitation professionals including physical medicine and
rehabilitation specialists, physiotherapists, occupational therapists, speech therapists, and audiologists were 3.90,
64.65, 22.09, 22.83 and 24.18 per 1,000,000 populations, respectively.
Conclusion: There is a need to increase the availability of rehabilitation services and to promote rehabilitation
referrals by using an interdisciplinary team approach