Molecular characterization, cloning and sequencing of coat protein gene of a Pakistani potato leaf roll virus isolate and its phylogenetic analysis

Total RNA was extracted from potato leaf roll virus (PLRV) positive potato plants and complementary DNA were synthesized. Reverse transcriptase polymerase chain reaction (RT-PCR) based detection conditions were optimized by using coat protein (CP) gene specific primers. A 346 bp amplicon of PLRV- coat protein (CP) gene was amplified. Amplified CP-gene of PLRV was cloned in TA cloning vector, PCR ® 2.1. The clone was confirmed subsequently through restriction digestion analysis. PCR amplification used cDNA clone as a template and nucleotide sequencing. Expected nucleotide sequence of amplified PLRV-CP gene show homology of 94 to 97% when compared to the sequences already reported in GenBank database. This explored novel PLRV-CP gene was submitted at NCBI GenBank for characterization of PLRV Pakistani isolate (Accession No. JN039286). Phylogenetic analysis was also carried out and tree was made by using MEGA 4.0.Key words: Potato, potato leaf roll virus (PLRV), coat protein (CP) gene, reverse transcriptase polymerase chain reaction (RT-PCR), PLRV-CP Pakistani isolate

Study of Postdatism with Respect to Fetomaternal Outcome at A Tertiary Care Hospital

OBJECTIVES This study aims to know our setup’s fetomaternal pregnancy complications that extend beyond 40 weeks of gestation. METHODOLOGY This is a prospective cross-sectional study of 390 patients with uncomplicated postdated pregnancies fulfilling the inclusion and exclusion criteria admitted to the department of Obstetrics and Gynecology (both in spontaneous labour and induced patient) at Hayatabad Medical Complex, a tertiary care hospital in Peshawar, KPK from July 2020 to June 2021.RESULTS Out of 390 patients, a majority (72.30 %) were in the age group of 20 – 35 years. Most of them (50.51%) presented at gestation 40+1 – 40+6 weeks. The majority (57.69%) were multigravida, and most (93.07%) were un-booked. Most delivered vaginally (80.51%), and 19.48% had C/section (including both emergency and elective). The most common indication for C/section was fetal distress (44.73%), followed by C/section on demand (18.42%). The majority>90% had Apgar score greater than seven at 5 minutes which was gestation dependent. Overall perinatal mortality was 4.07% which was also gestation dependent ranging from 0.5% at 40+1 – 40+6 weeks to 2.30% at and beyond 42 weeks of gestation. Neonatal morbidity in the form of Birth asphyxia, Meconium Aspiration Syndrome (MAS), Shoulder Dystocia and NICU admission also showed an increasing tendency with increasing gestation beyond 40 weeks. Maternal morbidity in the form of PPH, perineal tears 3°/4° and endometritis also showed a similar increasing trend with increasing gestation beyond 40 weeks. CONCLUSION Pregnancy continuing beyond 40 weeks has a definite risk to the fetus.

Viability assessment of in vitro produced synthetic seeds of cucumber

Friable, embryogenic calli of F1 cucumber (Cucumis sativus) cultivar, Royal, were induced from the hypocotyl pieces cultured on solidified MS-basal media supplemented with 2,4-dichlorophenoxy acetic acid (2,4-D) and benzyl amino purine (BAP). Embryogenic calli were transferred to liquid Murashige and Skoog (MS)-basal  media supplemented with 5 ƒÊM naphthaleneacetic acid (NAA) and 1 µM BAP. The mature somatic embryos  were encapsulated in sodium alginate mixture in synthetic seeds. The encapsulation mixture containing 3%  sodium alginate, 100 mM calcium chloride and one-fourth volume of the cell suspension nutrient mixture  containing 5x10-4 somatic embryos per ml was found the best. Synthetic seeds remain viable up to 14 weeks  when stored at 4°C. Germination efficiency of synthetic seeds was decreased to 57% after 10 weeks of  storage followed by rapid decrease in survival rate to 0% after 15 weeks. Genetic diversity between mother  plants and in vitro produced synthetic seeds showed resemblance as assessed by amplified fragment length polymorphism (AFLP) markers.Key words: Artificial seed, Cucumis sativus, encapsulation, somatic embryogenesis, sodium-calcium alginate

Research article Characterization of broad-spectrum biocontrol efficacy of Bacillus velezensis against Fusarium oxysporum in Triticum aestivum L.

Fungi are the most important phytopathogens that cause yield losses. The mycotoxins released by fungi cause spoilage of stored food consumed by humans and feed supplied to animals. Fungi-antagonistic microbes are gaining attention as potential biocontrol agents (BCAs). This study was designed to isolate bacterial isolates from different crops and evaluate their in vitro antifungal assay against three phytopathogens, plant growth promoting (PGP) characteristics, molecular identification, and in vivo efficiency against the most devastating phytopathogenic fungus Fusarium oxysporum Schltdl. In the in vitro experiment, the 3 isolates BA, GL-1, and 5a out of 360 isolates showed more than 60% inhibitory activity against the selected fungi in this study. On the basis of 16S rRNA sequencing and phylogenetic analysis, BA isolate was identified as Bacillus velezensis. All three isolates produced indole acetic acid (IAA), hydrogen cyanide (HCN), and cellulase enzymes, while the BA and GL-1 isolates also produced siderophores and the BA isolate also produced ammonia. BA was selected on basis of not only Biocontrol efficacy but also maximum PGPR activity compared to GL-1 and 5a. In vivo assay, the isolate BA showed a significant decrease in disease severity caused by Fusarium oxysporum by 64.97% after 100 days of inoculation on wheat (FD-08) seedlings in a greenhouse assay and enhanced the shoot root height, fresh and dry mass. The wide-ranging antagonistic action of Bacillus velezensis isolated from the phyllosphere of wheat crops showed promising fungicidal and plant growth-promoting capabilities, suggesting it can be used as a biofungicide

Characterization and efficiency assessment of PGPR for enhancement of rice (Oryza sativa L.) yield

Background: Plant growth promoting rhizobacteria (PGPR) play an important role in phosphorous solublization, nutrient uptake and crop productivity. A variety of PGPR and their combinations were supplemented to rice crop for evaluation of their effects on plant height, filled grain per panicle, tillers per plant, 1000 grain weight, panicle length and yield per acre.    Methods: Roots of sugarcane plants and their adhering soil samples were used as an isolation source for PGPR. The nursery plant roots of local rice varieties i.e. Super Basmati and Basmati-515 were inoculated with isolated PGPR formulation. Data was recorded and statistically analyzed to determine analysis of variance, genetic correlation, path coefficient and principle component. Results: 5 out of 11 bacterial strains produced high indole acetic acid (IAA). Other 6 were either average or low producers of the acid. The strains selected for maximum amount of phosphorous solublization were CEMB-22 (Klebsiella sp.) and CEMB-15 (Burkholderia sp.) with best IAA production. It was found that higher genetic advance, heritability, genotypic and phenotypic correlation have positive direct effects on yield properties of rice.Conclusion: Yield of rice can be enhanced by the application of CEMB-22+CEMB-15 PGPR in combined formulation

The development of cost effective 100 base pair prototype DNA ladder using polymerase chain reaction

Background: In genomics, DNA scale is used as a standard unit for the measurement of unknown DNA fragments, plasmids, and PCR products during gel electrophoresis. The 100 base pair DNA ladder is essential and cost-effective in molecular biological research and is available commercially which is too expensive and not easily accessible to a common researcher for laboratory usage.Methods: The main purpose of this study was to report easily and practical method to prepare 100 base pair DNA ladder by simple PCR using pCAMBIA 1301 plasmid as a template which is an effective cost reduction strategy for laboratories. pCAMBIA 1301 was transformed into Escherichia coli (Top 10) bacteria by using heat shock method for high the yield of the plasmid. Bacteria containing our desire plasmid were cultured and plasmid was extracted from bacteria by using kit method. About 10 pairs of primers were designed from the backbone of the plasmid which amplifies 100 to 1000 base pair of PCR product with an interval of 100 base pair fragments. These fragments were optimized by using gradient thermo cycler and PCR products were purified using kit methods. For the stability of 100 base pair DNA ladder, it was placed in seven different buffers.Results: The outcome of this study shown that polymerase chain reaction was able to amplify 10 different types of DNA fragments which ranges from 100 to 1000 base pair with high qualification and size accuracy. PCR products were purified and sequenced. DNA ladder was pooled in seven different buffers and stored at -20°C. These buffers were used to optimize and evaluate the stability of the prototype DNA ladder.Conclusion: Our laboratory made 100base pair DNA ladder is very cost effective, it only cost 11 USD to prepare DNA ladder. This 100 base pair DNA ladder provides an independent quantitative unit that can be used with any biological application or technology, enabling genomes to be measured using a common metric.Keywords: 100 bp DNA ladder, pCAMBIA 1301 plasmid; PCR technique; Gel electrophoresis; Break Even Point Analysis   

Molecular detection, phylogenetic analysis and designing of siRNA against Potato Virus X

Background: As potato (Solanum tuberosum L.) is one of the most liked food crops for human diet so increasing its production is an important goal for scientists to achieve. In this molecular study, we characterized the Coat Protein (CP) gene of Potato Virus X (PVX). CP gene is virulence mediator and integral part of viral structural assembly.Methodology: We tissue cultured the PVX positive potato plants for viral RNA extraction. Total RNA was converted to cDNA for priming CP gene in PCR for amplification. To get the complete sequence of gene, we cloned CP gene into pTZ57R/T cloning vector. Upon double digestion of recombinant plasmid with EcoRI and HindIII restriction enzymes, 710 bp fragment was obtained which confirmed cloning. Recombinant plasmid was sequenced with M13 primers.Results: Derived consensus sequence of 710 bp was found to be exact cds of CP gene showing 95% similarity with referenced genome. Phylogenetic analysis suggested Indian isolate of PVX as the nearest one. Multiple siRNA were designed against mentioned and optimized computationally to provide base for further studies.Conclusion: Following facts may be established upon findings of this research; i) CP gene of Pakistani isolate of PVX has high homology with other PVX isolates found around the world, ii) in determining target for efficient siRNA mediated approach to silence PVX genome, this conserved nature can be proved very promising. Thus, to develop PVX-resistant potato crop in Pakistan through siRNA mediated strategy, CP gene could be the best target

Multiple interval mapping of QTLs and epistasis for iron toxicity tolerance in segregating population of Indica rice

The global average temperature has increased by approximately 0.5 °C, over a last few decades and is projected to continue to increase. Environmental stress factors such as, elevated temperature, salinity, toxic elements (Fe, Al, Cd, Cr, Pb, Zn and As), drought and rising CO2 affect plant growth and make a growing threat to agriculture. Rice is a primary food crop in the world and the establishment of rice crop in acidic soil and in marginal soil is a major goal for the improvement of rice production to fulfill the food security. Among environmental stresses, Fe2+ toxicity is one of the main stresses in limiting the cereal crops production. Tolerant rice genotypes that can tolerate the high concentration of Fe2+ toxicity are the potential source genes for rice tolerance improvement in Fe2+ toxicity. In this research work, the genetic basis of seed germination traits and growth traits was investigated in rice using (multiple interval mapping) MIM. Many rice genotypes serve as source of tolerant against toxic metal ion like Fe2+, could be an important factor in controlling the sever effect of Fe2+ toxicity on germination and seedling growth traits.  The F3 progenies of cross between Fe2+ toxicity tolerant cultivar ‘Pokkali’ and susceptible cultivar ‘Pak basmati’ were test against the optimized level of Fe2+ toxicity at germination, to determine the mode of inheritance to Fe2+ toxicity tolerance. Wide range of continues variation was found in F3 progenies. Among the 49 quantitative germination trait and 23 growth trait loci (QTLs) on chromosomes 1, 2, 4, 6, 8 and 9 linked with tolerance to Fe2+ toxicity was mapped. Additionally, 21 QTLs for germination traits and 9 QTLs for growth traits were classified as major QTLs using MIM. For germination and growth traits, notable epistasis between the chromosome 1, 2, 4, 6 and 11 was detected across germination and growth traits. Our results suggest that the tolerance mechanisms at germination and seedling phases could differ for Fe2+ toxicity. QTLs detected in this study for germination and seedling growth could be a source of new alleles for development of tolerance rice to Fe2+ toxicity varieties and transformation, gene cloning and gene editing in the futur

Molecular characterization of capsid protein gene of potato virus X from Pakistan

Potato (Solanum tuberosum L.) is one of the most economically important vegetable crops in Pakistan. Chlorotic thickness veins spots intermingled with a dark green area, mosaic and decrease in size of the leaves were observed in the Lahore during a survey in 2009. Reverse transcriptase polymerase chain reaction (RT-PCR) based detection conditions were optimized for potato virus X using specific primers 5’-GGCGCAACTCCTGCCACAGC -3’ and 5’- TTGTTGTTCCAGTGATACGA -3’. 613 bp amplicon of capsid protein (CP) gene was amplified, cloned and sequenced (Accession number HE577130). Comparisons as well as phylogenetic reconstructions of CP sequence with PVX sequences retrieved from Genebank showed that the Pakistani PVX isolates (HE577130) has close relationship with USSR isolate. This is the first report on the molecular characterization of full length PVX coat protein sequence infecting potato from Pakistan. Homology of the sequenced gene of PVX with reported genes in Gene Data Bank was observed within the range of 90 and 99.7%. Maximum homology was observed to be 99.7% with the gene (Genebank accession No. M38480 and M72416).Keywords: Potato virus X, capsid protei