Molecular Aspects of the Interaction of Iminium and Alkanolamine Forms of the Anticancer Alkaloid Chelerythrine with Plasma Protein Bovine Serum Albumin

The interaction between a quaternary benzophenanthridine alkaloid chelerythrine (herein after, CHL) and bovine serum albumin (herein after, BSA) was probed by employing various spectroscopic tools and isothermal titration calorimetry (ITC). Fluorescence studies revealed that the binding affinity of the alkanolamine form of the CHL is higher compared to the iminium counterpart. This was further established by fluorescence polarization anisotropy measurement and ITC. Fluorescence quenching study along with time-resolved fluorescence measurements establish that both forms of CHL quenched the fluorescence intensity of BSA through the mechanism of static quenching. Site selective binding and molecular modeling studies revealed that the alkaloid binds predominantly in the BSA subdomain IIA by electrostatic and hydrophobic forces. From Forster resonance energy transfer (FRET) studies, the average distances between the protein donor and the alkaloid acceptor were found to be 2.71 and 2.30 nm between tryptophan (Trp) 212 (donor) and iminium and alkanolamine forms (acceptor), respectively. Circular dichroism (CD) study demonstrated that the α-helical organization of the protein is reduced due to binding with CHL along with an increase in the coiled structure. This is indicative of a small but definitive partial unfolding of the protein. Thermodynamic parameters obtained from ITC experiments revealed that the interaction is favored by negative enthalpy change and positive entropy change

Multispectroscopic and Theoretical Exploration of the Comparative Binding Aspects of Bioflavonoid Fisetin with Triple- and Double-Helical Forms of RNA

The interactions of RNA triplex (U.A*U) and duplex (A.U) with naturally occurring flavonoid fisetin (FTN) have been examined at pH 7.0 using various spectroscopic, viscometric, and theoretical studies. Experimental observations showed that the ligand binds with both double- and triple-helical forms of RNA, although the binding affinity is greater for the triplex structure (5.94 × 10⁶ M^–1) compared to that for the duplex counterpart (1.0 × 10⁵ M^–1). Thermal melting experiments revealed that the Hoogsteen base-paired third strand of triplex was stabilized to a greater extent (∼14 °C) compared with the Watson–Crick base-paired second strand (∼4 °C) in the presence of FTN. From fluorimetric study, we observed that U.A*U and A.U primarily bind to the photoproduced tautomer of FTN in the excited state. Steady-state and time-resolved anisotropy measurements illustrate considerable modulations of the spectroscopic properties of the tautomeric FTN within the RNA environment. Viscometric, fluorescence quenching, and thermal melting studies all together support the mode of binding to be intercalation. Theoretical study explains the experimental absorption and emission (dual fluorescence) behavior of FTN along with the excited-state intramolecular proton transfer process

Deciphering the Positional Influence of the Hydroxyl Group in the Cinnamoyl Part of 3‑Hydroxy Flavonoids for Structural Modification and Their Interaction with the Protonated and B Form of Calf Thymus DNA Using Spectroscopic and Molecular Modeling Studies

Studies on the interaction of naturally occurring flavonoids with different polymorphic forms of nucleic acid are helpful for understanding the molecular aspects of binding mode and providing direction for the use and design of new efficient therapeutic agents. However, much less information is available on the interactions of these compounds with different polymorphic forms of DNA at the molecular level. In this report we investigated the interaction of two widely abundant dietary flavonoids quercetin (Q) and morin (M) with calf thymus (CT) DNA. Spectrophotometric, spectropolarimetric, viscosity measurement, and molecular docking simulation methods are used as tools to delineate the binding mode and probable location of the flavonoids and their effects on the stability and conformation of DNA. It is observed that in the presence of the protonated form of DNA the dual fluorescence of Q and M resulting from the excited-state intramolecular proton transfer (ESIPT) is modified significantly. Structural analysis showed Q and M binds weakly to the B form (groove binding) compared to the protonated form of CT DNA (electrostatic interaction). In both cases, Q binds strongly to both forms of DNA compared to M

Domain-Specific Association of a Phenanthrene–Pyrene-Based Synthetic Fluorescent Probe with Bovine Serum Albumin: Spectroscopic and Molecular Docking Analysis

In this report, the interaction between a phenanthrene–pyrene-based fluorescent probe (PPI) and bovine serum albumin (BSA), a transport protein, has been explored by steady-state emission spectroscopy, fluorescence anisotropy, far-ultraviolet circular dichroism (CD), time-resolved spectral measurements, and molecular docking simulation study. The blue shift along with emission enhancement indicates the interaction between PPI and BSA. The binding of the probe causes quenching of BSA fluorescence through both static and dynamic quenching mechanisms, revealing a 1:1 interaction, as delineated from Benesi–Hildebrand plot, with a binding constant of ∼10⁵ M^–1, which is in excellent agreement with the binding constant extracted from fluorescence anisotropy measurements. The thermodynamic parameters, Δ<i>H</i>°, Δ<i>S</i>°, and Δ<i>G</i>°, as determined from van’t Hoff relationship indicate the predominance of van der Waals/extensive hydrogen-bonding interactions for the binding phenomenon. The molecular docking and site-selective binding studies reveal the predominant binding of PPI in subdomain IIA of BSA. From the fluorescence resonance energy transfer study, the average distance between tryptophan 213 of the BSA donor and the PPI acceptor is found to be 3.04 nm. CD study demonstrates the reduction of α-helical content of BSA protein on binding with PPI, clearly indicating the change of conformation of BSA

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

<p>Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M⁻¹], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M⁻¹, and that of BER was (0.98 ± 0.03) × 10⁵ M⁻¹. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.</p