Additional file 1: Figure S1a. of Development, genetic mapping and QTL association of cotton PHYA, PHYB, and HY5-specific CAPS and dCAPS markers

The examples of PHYBdCAPs-2 markers segregating among TM-1 × 3–79 RIL lines. (M) – Molecular-weight size marker of 25-bp ladder, ‘TM-1’ and ‘Pima 3–79’ – parents, F1 – first-generation hybrid, 13–51 – RIL individuals. Note: the 144-bp band is more intensive in G. hirsutum and the 180-bp band is more intensive in G. barbadense genotypes, while 36-bp band is not visible to detect. Heterozygots show two intensive bands of 180- and 144-bp, respectively. Primer information for PHYBdCAPs-2: F-5’GAAGATCATAAAAAGGCTATATACGTGGTGGTTA3’; R-5’CAAAGGATTGGGACTATGAACAATGG3’; Figure S1b. Genetic linkage maps with integration of PHYBdCAPs and PHYBdCAPs-2 corresponding to chromosome 10 of the A-sub-genome [48, 49]. QTL designations on the map are follows as Ns - nep size; Nn - number of neps; UQL - upper quartile of fiber length by weight; SFC - short fiber content by weight g; ALFw - average length of all fiber by weight; 5.0 L - fiber span length; 2.5 L - fiber span length; VFM – visible foreign matter in percentage; FTX - fiber fineness; IFC - immature fiber content by weight g; MR - maturity ratio; MT - mean tenacity; and ME - mean elongation. (DOCX 820 kb

Genome-wide identification and characterization of microRNAs differentially expressed in fibers in a cotton phytochrome A1 RNAi line

<div><p>Cotton fiber is an important commodity throughout the world. Fiber property determines fiber quality and commercial values. Previous studies showed that silencing phytochrome A1 gene (<i>PHYA1</i>) by RNA interference in Upland cotton (<i>Gossypium hirsutum</i> L. cv. Coker 312) had generated <i>PHYA1</i> RNAi lines with simultaneous improvements in fiber quality (longer, stronger and finer fiber) and other key agronomic traits. Characterization of the altered molecular processes in these RNAi genotypes and its wild-type controls is a great interest to better understand the <i>PHYA1</i> RNAi phenotypes. In this study, a total of 77 conserved miRNAs belonging to 61 families were examined in a <i>PHYA1</i> RNAi line and its parental Coker 312 genotype by using multiplex sequencing. Of these miRNAs, seven (miR7503, miR7514, miR399c, miR399d, miR160, miR169b, and miR2950) were found to be differentially expressed in <i>PHYA1</i> RNAi cotton. The target genes of these differentially expressed miRNAs were involved in the metabolism and signaling pathways of phytohormones, which included Gibberellin, Auxin and Abscisic Acid. The expression of several MYB transcription factors was also affected by miRNAs in RNAi cotton. In addition, 35 novel miRNAs (novel miR1-novel miR35) were identified in fibers for the first time in this study. Target genes of vast majority of these novel miRNAs were also predicted. Of these, nine novel miRNAs (novel-miR1, 2, 16, 19, 26, 27, 28, 31 and 32) were targeted to cytochrome P450-like TATA box binding protein (TBP). The qRT-PCR confirmed expression levels of several differentially regulated miRNAs. Expression patterns of four miRNAs-targets pairs were also examined via RNA deep sequencing. Together, the results imply that the regulation of miRNA expression might confer to the phenotype of the <i>PHYA1</i> RNAi line(s) with improved fiber quality.</p></div

Distribution of mapped sequence reads.

<p>Distribution of mapped sequence reads.</p

Validation of expression patterns of differentially-expressed-known miRNAs in 10 DPA-fiber of <i>PHYA1</i>-RNAi line by qRT-PCR.

<p>The miRNA expression was represented as relative fold change 2^-ΔΔCT (ΔΔC_T = ΔC_{T RNAi} - ΔC_{T Coker 312}). The expression levels of miRNA were normalized by using U6 snRNA as a reference. Three biological replicates and three technical replicates were used for qRT-PCR analysis. The error bar represent the confidence limits. RF and CF denote fibers from RNAi and Coker 312 lines, respectively. MIR 169b was not detected in 10-DPA fiber by MIR Seq.</p

Trim reads statistics from raw data image file.

<p>Trim reads statistics from raw data image file.</p

Inverse correlation between the expression of four novel miRNAs and their target genes.

<p>(A) RNA Sequencing and qRT-PCR analysis of predicted target genes of four novel miRNAs in 10 DPA fiber; (B) miRNA Sequencing and qRT-PCR analysis of four novel miRNAs in 10 DPA fiber. Gene expression was represented as fold change 2^-ΔΔCT (ΔΔC_T = ΔC_{T RNAi} - ΔC_{T Coker 312}). The expression levels of the genes were normalized by <i>UBQ7</i> (Gen bank accession NO. DQ116441) and U6 snRNA as internal references for mRNAs and miRNAs, respectively. Three biological replicates and three technical replicates were included for qRT-PCR assays. The error bar represent the confidence limits.</p

Novel miRNAs identified in all libraries.

<p>Novel miRNAs identified in all libraries.</p

Genetic linkage map of the F₃ population showing the location of QTL for photoperiodic flowering.

<p>Genetic linkage map of the F₃ population showing the location of QTL for photoperiodic flowering.</p

Genetic variances and estimated broad-sense heritability of traits in the F₃ population.

<p>Genetic variances and estimated broad-sense heritability of traits in the F₃ population.</p

The cross-combination between the wild type of cotton species <i>G</i>. <i>darwinii</i> Watt with its photoperiod insensitive irradiation mutant line.

<p>A) Wild type, B) F₁ plant, and C) irradiation mutant line.</p