Comparative investigation of reusable and single-use flexible endoscopes for urological interventions

In order to evaluate the technical adaptability of a type of disposable endoscope compared to reusable flexible endoscopes, in vitro and in vivo studies were conducted. A disposable digital ureteroscope ("chip on tip") and two reusable endoscopes were investigated with respect to spatial resolution, geometric distortion in air and water the maximum. Additionally, the clinical performance of the disposable device was tested during clinical procedures (n = 20). The disposable endoscope showed an optical resolution of 6.72 lines/mm at 10 mm distance, similar to the other devices. In comparison, the disposable endoscope showed a barrel-shaped image distortion in air of -24.2%, which is in the middle range, but was best under water (-8.6%). The bendability of 297 degrees (275 mu m fiber) and 316 degrees (empty channel, 1.5 F basket) and the maximum irrigation (1 m: 58.1 ml/min, 2 m: 91.9 ml/min) were convincing. Clinically the maneuverability was very good in (13/20), good or satisfactory in (7/20). Visibility was evaluated as very good in (11/20), just in (1/20) either satisfactory or sufficient. The consistency of visibility was not affected in (19/20). In all cases there were no adverse events. The technical examination and clinical application of the disposable endoscope are of equal quality compared to reusable devices. Disposable endoscopes can be an alternative to reusable devices, but economic aspects such as reduction of repair costs, sterilization effort and additional waste must be taken into account

Silodosin inhibits noradrenaline-activated transcription factors Elk1 and SRF in human prostate smooth muscle.

The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation

The cAMP effector EPAC activates Elk1 transcription factor in prostate smooth muscle, and is a minor regulator of alpha 1-adrenergic contraction

Background: Prostate smooth muscle tone is regulated by alpha 1-adrenoceptor-induced contraction and cAMP-mediated relaxation. EPAC is an effector of cAMP, being involved in smooth muscle relaxation and cell cycle control outside the lower urinary tract. Here, we investigated the expression and function of EPAC in human prostate tissues from patients undergoing radical prostatectomy. Results: mRNA and protein expression of EPAC was detected in all prostate tissues by RT-PCR and Western blot analysis. Immunoreactivity was observed in stromal cells, and colocalized with immunofluorescence for a-smooth muscle actin and calponin. Under normal conditions, noradrenaline-or phenylephrine-induced contraction of prostate strips in the organ bath was not affected by the EPAC activator pCPT (SP-8-pCPT-2'-O-Me-cAMPS.NA) (30 mu M). However, when the cyclooxygenase inhibitor indomethacin (50 mu M) was added, EPAC activators pCPT and OME (8-CPT-2'-O-Me-cAMP.Na) (30 mu M) significantly reduced contractions by low concentrations of phenylephrine. These effects were not observed on noradrenaline-induced contraction. OME and pCPT caused phosphorylation of the transcription factor Elk1 in prostate tissues. Elk1 activation was confirmed by EMSA (electrophoretic mobility shift assay), where OME and pCPT incresed Elk1 binding to a specific DNA probe. Conclusions: EPAC activation may reduce alpha 1-adrenergic prostate contraction in the human prostate, although this effect is masked by cyclooxygenases and beta-adrenoceptors. A main EPAC function in the human prostate may be the regulation of the transcription factor Elk1

Concentration-dependent alpha(1)-Adrenoceptor Antagonism and Inhibition of Neurogenic Smooth Muscle Contraction by Mirabegron in the Human Prostate

Introduction: Mirabegron is available for treatment of storage symptoms in overactive bladder, which may be improved by β3-adrenoceptor-induced bladder smooth muscle relaxation. In addition to storage symptoms, lower urinary tract symptoms in men include obstructive symptoms attributed to benign prostatic hyperplasia, caused by increased prostate smooth muscle tone and prostate enlargement. In contrast to the bladder and storage symptoms, effects of mirabegron on prostate smooth muscle contraction and obstructive symptoms are poorly understood. Evidence from non-human smooth muscle suggested antagonism of α1-adrenoceptors as an important off-target effect of mirabegron. As α1-adrenergic contraction is crucial in pathophysiology and medical treatment of obstructive symptoms, we here examined effects of mirabegron on contractions of human prostate tissues and on proliferation of prostate stromal cells. Methods: Contractions were induced in an organ bath. Effects of mirabegron on proliferation, viability, and cAMP levels in cultured stromal cells were examined by EdU assays, CCK-8 assays and enzyme-linked immunosorbent assay. Results: Mirabegron in concentrations of 5 and 10 μM, but not 1 µM inhibited electric field stimulation-induced contractions of human prostate tissues. Mirabegron in concentrations of 5 and 10 µM shifted concentration response curves for noradrenaline-, methoxamine- and phenylephrine-induced contractions to the right, including recovery of contractions at high concentrations of α1-adrenergic agonists, increased EC50 values, but unchanged Emax values. Rightshifts of noradrenaline concentration response curves and inhibition of EFS-induced contractions were resistant to L-748,337, l-NAME, and BPIPP. 1 µM mirabegron was without effect on α1-adrenergic contractions. Endothelin-1- and U46619-induced contractions were not affected or only inhibited to neglectable extent. Effects of mirabegron (0.5–10 µM) on proliferation and viability of stromal cells were neglectable or small, reaching maximum decreases of 8% in proliferation assays and 17% in viability assays. Mirabegron did not induce detectable increases of cAMP levels in cultured stromal cells. Conclusion: Mirabegron inhibits neurogenic and α1-adrenergic human prostate smooth muscle contractions. This inhibition may be based on antagonism of α1-adrenoceptors by mirabegron, and does not include activation of β3-adrenoceptors and requires concentrations ranging 50-100fold higher than plasma concentrations reported from normal dosing. Non-adrenergic contractions and proliferation of prostate stromal cells are not inhibited by mirabegron

Holmium:yttrium-aluminum-garnet laser induced lithotripsy: in-vitro investigations on fragmentation, dusting, propulsion and fluorescence

The fragmentation efficiency on Bego artificial stones during lithotripsy and the propulsive effect (via video tracking) was investigated for a variety of laser settings. A variation of the laser settings (pulse energy, pulse duration, repetition rate) altered the total application time required for stone fragmentation, the stone break up time, and the propulsion. The obtained results can be used to develop lithotripsy devices providing an optimal combination of low stone propulsion and high fragmentation efficacy, which can then be evaluated in a clinical setting. Additionally. the fluorescence of human kidney stones was inspected endoscopically in vivo. Fluorescence light can be used to detect stone-free areas or to clearly distinguish calculi from surrounding tissue or operation tools

Inhibition of Female and Male Human Detrusor Smooth Muscle Contraction by the Rac Inhibitors EHT1864 and NSC23766

Introduction: Lower urinary tract symptoms (LUTS) due to overactive bladder (OAB) are caused by spontaneous detrusor contractions. Medical treatment with muscarinic receptor antagonists or β3-adrenoceptor agonists aims to inhibit detrusor contractions, but overall results are unsatisfactory. Consequently, improved understanding of bladder smooth muscle contraction and identification of novel compounds for its inhibition are needed to develop alternative options. A role of the GTPase Rac1 for smooth muscle contraction has been reported from the prostate, but is unknown in the human detrusor. Here, we examined effects of the Rac inhibitors NSC23766, which may also antagonize muscarinic receptors, and EHT1864 on contraction of human detrusor tissues. Methods: Female and male human detrusor tissues were obtained from radical cystectomy. Effects of NSC23766 (100 µM) and EHT1864 (100 µM) on detrusor contractions were studied in an organ bath. Results: Electric field stimulation induced frequency-dependent contractions of detrusor tissues, which were inhibited by NSC23766 and EHT1864. Carbachol induced concentration-dependent contractions. Concentration response curves for carbachol were shifted to the right by NSC23766, reflected by increased EC50 values, but unchanged Emax values. EHT1864 reduced carbachol-induced contractions, resulting in reduced Emax values for carbachol. The thromboxane analog U46619 induced concentration-dependent contractions, which remained unchanged by NSC23766, but were reduced by EHT1864. Conclusions: NSC23766 and EHT1864 inhibit female and male human detrusor contractions. NSC23766, but not EHT1864 competitively antagonizes muscarinic receptors. In addition to neurogenic and cholinergic contractions, EHT1864 inhibits thromboxane A2-induced detrusor contractions. The latter may be promising, as the origin of spontaneous detrusor contractions in OAB is noncholinergic. In vivo, both compounds may improve OAB-related LUTS

Ghrelin Aggravates Prostate Enlargement in Rats with Testosterone-Induced Benign Prostatic Hyperplasia, Stromal Cell Proliferation, and Smooth Muscle Contraction in Human Prostate Tissues

Epidemiologic studies revealed a context between lower urinary tract symptoms (LUTS) suggestive of benign prostatic hyperplasia (BPH) and metabolic syndrome. However, molecular mechanisms underlying this relationship are largely unknown. Prostate enlargement and increased prostate smooth muscle tone are important factors in the pathophysiology of LUTS suggestive of BPH. In the present study, we studied effects of the metabolic hormone ghrelin on prostate enlargement in rats with experimentally induced BPH, growth of cultured stromal cells from human prostate (WPMY-1), and smooth muscle contraction of human prostate tissues. Ghrelin (20 nmol/kg daily, p.o., 2 weeks) increased prostate size in rats with testosterone-induced BPH. Microarray identified 114 ghrelin-upregulated genes (2-fold or more) in these prostates, with possible roles in growth, smooth muscle contraction, or metabolism. 12 genes were selected for further analyses. In human prostate tissues, mRNA levels of 11 of them correlated positively with ghrelin receptor (GHSR) expression, but only two with the degree of BPH. Accordingly, no correlation was evident between GHSR expression level and BPH in human prostate tissues. In WPMY-1 cells, the GHRS agonist MK0677 upregulated 11 of the selected genes. MK0677 induced proliferation of WPMY-1 cells, shown by EdU assay, colony formation, proliferation markers, flow cytometry, and viability. In myographic measurements, GHSR agonists enhanced contractions of human prostate strips. Together, ghrelin may aggravate prostate enlargement, stromal cell growth, and prostate smooth muscle contraction in BPH. Ghrelin may deteriorate urethral obstruction independently from BPH, qualifying the ghrelin system as an attractive new target to be tested for LUTS treatment in BPH

Coupling of alpha(1)-Adrenoceptors to ERK1/2 in the Human Prostate

Introduction: alpha(1)-Adrenoceptors are considered critical for the regulation of prostatic smooth muscle tone. However, previous studies suggested further alpha(1)-adrenoceptor functions besides contraction. Here, we investigated whether alpha(1)-adrenoceptors in the human prostate may activate extracellular signal-regulated kinases (ERK1/2). Methods: Prostate tissues from patients undergoing radical prostatectomy were stimulated in vitro. Activation of ERK1/2 was assessed by Western blot analysis. Expression of ERK1/2 was studied by immunohistochemistry. The effect of ERK1/2 inhibition by U0126 on phenylephrine-induced contraction was studied in organ-bath experiments. Results: Stimulation of human prostate tissue with noradrenaline (30 mu M) or phenylephrine (10 mu M) resulted in ERK activation. This was reflected by increased levels of phosphorylated ERK1/2. Expression of ERK1/2 in the prostate was observed in smooth muscle cells. Incubation of prostate tissue with U0126 (30 mu M) resulted in ERK1/2 inhibition. Dose-dependent phenylephrine-induced contraction of prostate tissue was not modulated by U0126. Conclusions: alpha(1)-Adrenoceptors in the human prostate are coupled to ERK1/2. This may partially explain previous observations suggesting a role of alpha(1)-adrenoceptors in the regulation of prostate growth. Copyright (C) 2011 S. Karger AG, Base

Исследование возможности реализации концепции радиационного эквивалентного обращения с РАО

в данной работе проведено исследование возможности реализации концепции радиационного эквивалентного обращения с радиоактивными отходами путём использования разработанного программного продукта для расчёта изотопного состава отработавшего ядерного топливаin this work, the feasibility of implementing the concept of radiation equivalent treatment of radioactive waste by using a developed software product for calculating the isotope composition of spent nuclear fue