Important Protozoan Parasites In Indonesia

The most important protozoan parasites in Indonesia are the malaria parasites, Toxoplasma gondii and Entamoeba histolytica. After the second world war the residual insecticides and effective antimalarial drugs were used in the control of malaria. After development of resistance among mosquitoes to insecticides, the Malaria Control Programme was switched over to the Malaria Eradication Programme. Malaria incidence dropped heavily. However, due to the quick development of vector resistance and financial limitations, malaria came back and so did the Malaria Control Programme. P. falciparum and P.vivax are the most common species in Indonesia. Important vectors are An. sundaicus, An. aconitus, An. maculatus, An. hyrcanus group, An. balabacensis, An. farauti etc. An. sundaicus and An. aconitus have developed resistance to DDT and Dieldrin in Java. In 1959 the Malaria Eradication Programme was started in Java, Bali and Lampung. In 1965 the API dropped to 0,15 per thousand. From 1966 onwards malaria transmission was on the increase, because spraying activities were slowed down, but dropped again from 1974 onwards by occasional residual house spraying with DDT or Fenitrothion, malaria surveillance and treatment of malaria cases, resulting in an API of 0.18 per thousand in 1987. At present malaria is not transmitted in Jakarta and in capitals of the provinces and kabupatens, except in Irian Jaya, Nusa Tenggara Timur and one or two other provinces, but it still exists in rural areas. The distribution of chloroquine resistant P.falciparum is patchy. Resistance is at the RI, RII and RUT levels. The main problems of malaria control are : the increasing development of resistance of the vector to insecticides, the change of An.aconitus from zoophili to anthropophili and from indoor to outdoor biting, the increasing resistance of P.falciparum to chloroquine, the shortage of skilled manpower and limitation of budget. In Indonesia many newborns with congenital anomalies are found. T. gondii as one of the causes, is widely spread in man and animals. The prevalence of Toxoplasma antibodies in man varies from 2 % to 63 %, in cats and other animals it can reach up to 75%. Confirmed cases of congenital toxoplasmosis are reported. The diagnosis of toxoplasmosis in the Department of Parasitology, University of Indonesia is done with detection of specific IgM and IgG antibodies with ELISA. A test for antigenemia to get a rapid and direct diagnosis of active infection is not yet available. A suitable Toxoplasma vaccine to prevent toxoplasmosis would be desirable. E. histolytica infection is endemic throughout the archipelago. The prevalence rates are 18% to 25% . Extraintestinal infection mostly occurs in the liver. Pulmonary amebiasis is occasionally found. Medication with metronidazole has obtained good results. Diagnosis of extraintestinal amebiasis in our laboratory is by the immunodiffusion test, which is not capable to differentiate active infection from infection in the past. A more accurate diagnosis would be the use of monoclonal antibodies to detect antigens

The Impact of Ddt Spraying and Malaria Treatment on the Malaria Transmission in a Hypo-endemic Area of South Kalimantan

Dari tahun 1979 sampai dengan 1981 dilaksanakan penelitian epidemiologi malaria disuatu daerah hypo-endemis di Kalimantan Selatan. Sebagian dari penelitian yang dilaporkan di sini, menilai hasil pe­nyemprotan rumah dengan DDT yang dilaksanakan secara rutin oleh Dinas Kesehatan Propinsi serta menilai intervensi yang diadakan atas dasar epidemiologi setempat. Daerah transmigrasi Batutungku di­semprot secara rutin dan hasilnya dibandingkan dengan Panyipatan, suatu desa yang tidak disemprot. Hasil surveillance menunjukkan bahwa incidence rate tiap tahun selama tiga tahun penelitian di kedua daerah turunnya sama : di Batutungku dari 10,20/00 menjadi 8,70/00 pada tahun 1980 dan 5,30/00 pada tahun 1981, dan di Panyipatan dari 16,60/00 menjadi 14,60/00 pada tahun 1980 dan 7,70/00 pada tahun 1981. Fluktuasi kepadatan An. Nigerrimus dan An. peditaeniatus, dua species anopheles yang paling banyak tertangkap di daerah penelitian, juga tidak menunjukkan adanya perbedaan di kedua dae­rah. Dengan incidence rate dan data entomologis ini, dibuktikan bahwa penyemprotan rumah-rumah di Batutungku tidak efektif. Bahwa di kedua daerah incidence rate tiap tahun menurun, disebabkan oleh radical treatment yang dimulai di kedua daerah sejak Oktober 1979. Mass treatment "di dua R W di Batutungku di mana incidence malaria per bulan lebih tinggi daripada lain-lain R W, dapat menekan malaria transmisi

Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain Reaction

Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. In healthy persons (immunocompetent) the infection is usually asymptomatic; however in immunocompromised patients, especially AIDS patients, the infection can be fatal. Primary infection in pregnant women can be transmitted to the fetus via the placenta. Therefore laboratory examination is absolutely neccesary to assess the presence of T.gondii infection hence prompt treatment can be given to prevent further damage. The aim of this study is to know whether by using P30 gene as target the Polymerase chain reaction (PCR) can detect T.gondii DNA in Indonesia. The PCR was performed on the DNA which had been isolated against P30 gene as target by using the method described by Weiss et al and Chang & Ho. The P30 gene primers consisted of oligo 1: 5’CACACGGTTGTATGTCGGTTTCGCT3’ and oligo 2: 5’TCAAGGAGCTCAATGTTAC GCT3’. The DNA samples used in the PCR with P30 gene as target were derived from the following materials: (a) pure T.gondii DNA of various concentrations, (b) a mixture of pure T.gondii DNA and normal human blood DNA, (c) tachyzoite DNA derived from the mixture of 99 ml normal human blood and 1 ml tachyzoite suspension with the following amount of tachyzoites :1000,100, 50, 40, 30, 20 and 10 tachyzoites. It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al). The PCR according to the method described by Chang & Ho did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. The results obtained showed that the minimal DNA concentrations which still could be detected using P30 gene as target were as follows : 0.001 ng DNA in 50 ml PCR solution from samples of pure DNA, 0.025 ng DNA in 50 ml PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites. It was concluded that the assay using P30 gene as target could be used for detecting T.gondii DNA in Indonesia

Distribution And Prevalence Of Malayan Filariasis In South Sulawesi, Indonesia

Untuk mendapatkan gambaran distribusi dan prevalensi penyakit filariasis di daerah transmigrasi Sulawesi Selatan, telah dikumpulkan data survey yang diadakan oleh Dinas Kesehatan Propinsi dan Ka­bupaten pada tahun 1972, 1973, 1976 dan 1979. Data diperoleh dari 82 desa dari 3 kecamatan, Mangkutana, Nuha, dan Wotu. Infeksi filariasis pada penduduk asli di Mangkutana (9.7%) lebih tinggi dari pada para transmigran (7.6%). Sedangkan pada penduduk asli di Nuha 3.6%, dan di Wotu 3.5%

Infectious Disease Risks to Transmigrant Communities in Indonesia : a Survey in Lampung Province, Sumatra

This study was supported in part by funds provided by the Indonesian Ministry of Health and The Naval Medical Research and Development Command, Navy Department for Work Unit MR041. 05-0052. The opinions and assertions contained herein are those of the authors and are not to be construed as official or as reflecting the views of the Indonesian Ministry of Health and the Navy De­partment or the Naval Service at large

Socio-demographic determinants of Toxoplasma gondii seroprevalence in migrant workers of Peninsular Malaysia

Background The number of migrants working in Malaysia has increased sharply since the 1970’s and there is concern that infectious diseases endemic in other (e.g. neighbouring) countries may be inadvertently imported. Compulsory medical screening prior to entering the workforce does not include parasitic infections such as toxoplasmosis. Therefore, this study aimed to evaluate the seroprevalence of T. gondii infection among migrant workers in Peninsular Malaysia by means of serosurveys conducted on a voluntary basis among low-skilled and semi-skilled workers from five working sectors, namely, manufacturing, food service, agriculture and plantation, construction and domestic work. Methods A total of 484 migrant workers originating from rural locations in neighbouring countries, namely, Indonesia (n = 247, 51.0%), Nepal (n = 99, 20.5%), Bangladesh (n = 72, 14.9%), India (n = 52, 10.7%) and Myanmar (n = 14, 2.9%) were included in this study. Results The overall seroprevalence of T. gondii was 57.4% (n = 278; 95% CI: 52.7–61.8%) with 52.9% (n = 256; 95% CI: 48.4–57.2%) seropositive for anti-Toxoplasma IgG only, 0.8% (n = 4; 95% CI: 0.2–1.7%) seropositive for anti-Toxoplasma IgM only and 3.7% (n = 18; 95% CI: 2.1–5.4%) seropositive with both IgG and IgM antibodies. All positive samples with both IgG and IgM antibodies showed high avidity (> 40%), suggesting latent infection. Age (being older than 45 years), Nepalese nationality, manufacturing occupation, and being a newcomer in Malaysia (excepting domestic work) were positively and statistically significantly associated with seroprevalence (P < 0.05). Conclusions The results of this study suggest that better promotion of knowledge about parasite transmission is required for both migrant workers and permanent residents in Malaysia. Efforts should be made to encourage improved personal hygiene before consumption of food and fluids, thorough cooking of meat and better disposal of feline excreta from domestic pets

The Determination of Chloroquine-resistant Falciparum Malaria in Nimboran, Irian Jaya

Di Kecamatan Nimboran, Irian Jaya dalam bulan Agustus 1979 dilaksanakan test resistensi Plasmo­dium falciparum terhadap chloroquine. Metode yang digunakan adalah in-vivo dan macro in-vitro test menurut prosedur Standard dari WHO. Tujuan penelitian ini adalah untuk mencari fokus dari P. falciparum yang resisten terhadap chloroquine dan membandingkan hasil dari kedua cara tersebut. Endemisitas malaria di Nimboran adalah sangat tinggi dengan spleen rate 72,7 % pada usia 5 -14 tahun dan parasite rate 15,8 % pada semua umur, meskipun telah diadakan penyemprotan rumah dengan DDT. Species malaria yang terbanyak ditemukan ialah P. falciparum. Telah dikerjakan 21 in-vivo test dan 28 macro in-vitro test dan ditemukan 2 kasus yang resisten in-vivo pada derajat RI dan RIII serta 5 kasus, yang resisten in-vitro: 1 kasus menunjukkan inhibisi pemben­tukan schizoni pada 3,0 nanomol, sedangkan 4 kasus sama sekali tidak menunjukkan inhibisi pemben­tukan schizont pada 3,0 nanomol. Dengan macro in-vitro test dialami banyak kegagalan (57%) dan kemungkinan-kemungkinan sebab kegagalan tersebut dibicarakan. Hasil dari penelitian membuktikan bahwa Kecamatan Nimboran, suatu daerah yang terpilih untuk menjadi daerah transmigrasi, merupakan fokus resistensi P. falciparum terhadap chloroquine