Monitoring the T-Cell Receptor Repertoire at Single-Clone Resolution

The adaptive immune system recognizes billions of unique antigens using highly variable T-cell receptors. The αβ T-cell receptor repertoire includes an estimated 10(6) different rearranged β chains per individual. This paper describes a novel micro-array based method that monitors the β chain repertoire with a resolution of a single T-cell clone. These T-arrays are quantitative and detect T-cell clones at a frequency of less than one T cell in a million, which is 2 logs more sensitive than spectratyping (immunoscope), the current standard in repertoire analysis. Using T-arrays we detected CMV-specific CD4+ and CD8+ T-cell clones that expanded early after viral antigen stimulation in vitro and in vivo. This approach will be useful in monitoring individual T-cell clones in diverse experimental settings, and in identification of T-cell clones associated with infectious disease, autoimmune disease and cancer

Transcriptional profiling of human Vδ1 T cells reveals a pathogen-driven adaptive differentiation program

γδ T cells are generally considered innate-like lymphocytes, however, an “adaptive-like” γδ compartment has now emerged. To understand transcriptional regulation of adaptive γδ T cell immunobiology, we combined single-cell transcriptomics, T cell receptor (TCR)-clonotype assignment, ATAC-seq, and immunophenotyping. We show that adult Vδ1+ T cells segregate into TCF7+LEF1+Granzyme Bneg (Tnaive) or T-bet+Eomes+BLIMP-1+Granzyme B+ (Teffector) transcriptional subtypes, with clonotypically expanded TCRs detected exclusively in Teffector cells. Transcriptional reprogramming mirrors changes within CD8+ αβ T cells following antigen-specific maturation and involves chromatin remodeling, enhancing cytokine production and cytotoxicity. Consistent with this, in vitro TCR engagement induces comparable BLIMP-1, Eomes, and T-bet expression in naive Vδ1+ and CD8+ T cells. Finally, both human cytomegalovirus and Plasmodium falciparum infection in vivo drive adaptive Vδ1 T cell differentiation from Tnaive to Teffector transcriptional status, alongside clonotypic expansion. Contrastingly, semi-invariant Vγ9+Vδ2+ T cells exhibit a distinct “innate-effector” transcriptional program established by early childhood. In summary, adaptive-like γδ subsets undergo a pathogen-driven differentiation process analogous to conventional CD8+ T cells

Differential usage of cellular niches by cytomegalovirus versus EBV- and influenza virus-specific CD8+ T cells

Immunological memory provides long-term protection against reinfection or reactivation of pathogens. Murine memory T cell populations may be compressed following infections with new pathogens. Humans have to retain memory T cells directed against a variety of microbes for many decades. Under these circumstances, the effect of pathogens that mount robust T cell reactivity on the pre-existing memory directed against unrelated microbes is unknown. In this study, we studied peripheral blood memory CD8+ T cells directed against different viruses following primary CMV infection in renal transplant recipients. The entrance of CMV-specific CD8+ T cells expanded the Ag-primed CD8+ T cell compartment rather than competing for space with pre-existing memory T cells specific for persistent or cleared viruses. Neither numbers nor phenotype of EBV- or influenza-specific CD8+ T cells was altered by primary CMV infection. CMV-specific CD8+ T cells accumulated over time, resulting in increased total CD8+ T cell numbers. Additionally, they acquired a highly differentiated cytolytic phenotype that was clearly distinct from EBV- or influenza-reactive T cells. Thus, the human immune system appears to be flexible and is able to expand when encountering CMV. In view of the phenotypic differences between virus-specific T cells, this expansion may take place in cellular niches different from those occupied by EBV- or influenza-specific T cells, thereby preserving immunity to these pathogens

The T-array protocol.

<div><p> <b>(A)</b> During development, VDJ recombination causes enormous variability in TCRβ chain by randomly selecting different combinations of 23 V, 2 D, and 13 J gene segments, by nucleotide insertion (), and by nucleotide deletion from V (), D, and J () genes.</p> <p>This results in a diversity of an estimated 10⁶ different β chains per individual.</p> <p> <b>(B)</b> N-deletion causes shortening of the Vβ and Jβ segments.</p> <p>The number of nucleotides deleted from Vβ and Jβ germline DNA is limited.</p> <p>N-deletion of 192 published TCRβ mRNAs was determined.</p> <p>The figure shows the cumulative percentage of CDR3βs for the number of nucleotides deleted.</p> <p>TCRβ's with n nucleotides deleted represent approximately 10% of the repertoire if n = 0 to 6, and 5%, if n = 7 to 9.</p> <p> <b>(C)</b> The T-array protocol: <b>(C1)</b> cDNA from T-cells is generated.</p> <p> <b>(C2)</b> CDR3β regions are PCR amplified using biotinylated Vβ-specific () or Vβ-generic primers (not shown here).</p> <p> <b>(C3)</b> Biotinylated strands are removed after alkaline denaturation using streptavidin-coated beads.</p> <p> <b>(c4)</b> Single-strands of polyclonal TCRs are aliquoted and hybridized to fluorescently labeled annealers () complementary to the NDN-adjacent end of a Jβ gene.</p> <p>A specific number of Jβ-gene nucleotides (n) is deleted for each annealer, accounting for N-deletion during the VDJ recombination process.</p> <p>Insert (C4): Each annealer will hybridize to TCRβ rearrangements where n nucleotides are deleted from the Jβ-germline gene segment (<b>C4A</b>) or where less than n nucleotides are deleted (<b>C4B</b>).</p> <p> <b>(C5)</b> The annealer-hybridized fractions are loaded on universal hexamer arrays for <b>(C6)</b> T-cell-clone-specific ligation and, <b>(C7)</b> subsequently washed, scanned and analyzed.</p></div

Comparison of the diversity of the human TCRb repertoire and the sensitivity of various methods for repertoire analysis.

<div><p> <b>(A)</b> The human T-cell repertoire contains an estimated 10⁶ rearrangements per individual (<i><a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone.0000055-Arstila1" target="_blank">ref. 2</a></i>).</p> <p> <b>(B)</b> The sensitivity of Vβ/Cβ immunoscope is approximately 2 in 10⁴ (<i><a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone.0000055-Hohlfeld1" target="_blank">ref. 15</a> and </i><a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone-0000055-g003" target="_blank"><i>Fig. 3A</i></a>).</p> <p> <b>(C)</b> Based on the number of Jβ primers, it is estimated that Vβ/Jβ immunoscope is 12-fold more sensitive than Vβ-Cβ immunoscope.</p> <p> <b>(D,E)</b> The sensitivity by which TCR rearrangements are picked by indivual cloning, depends on the number of clones sequenced (<i><a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone.0000055-Betts1" target="_blank">ref. 5</a>–<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone.0000055-Rohrlich1" target="_blank">9</a></i>).</p> <p> <b>(F)</b> The sensitivity of the T-array is approximately 1 in 10⁶ rearrangements (<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone-0000055-g003" target="_blank"><i>Fig. 3C</i></a>).</p></div

Ligation experiments with Jurkat CDR3β amplicons.

<div><p> <b>(A)</b> VDJ rearrangement of Jurkat TCRβ.</p> <p>In this CDR3 sequence, there are 3 and 0 nucleotides deleted form the germline Vβ and Jβ, respectively.</p> <p> <b>(B–E)</b> Capillary-electrophoresis chromatograms showing length and signal of fluorescent annealers ().</p> <p> <b>(B)</b> A hexamer (GTTCGG) complementary to the Jurkat 3-end NDN sequence elongated (<b>*</b>) the Jβ1-2-specific annealer (♦).</p> <p> <b>(C)</b> The non-complementary 5′-end hexamer failed to cause elongation.</p> <p>Black peaks: Cy5 signal; Red peaks: FAM signal of size standards.</p> <p> <b>(D, E)</b> Similarly, a Cy5-labeled oligonucleotide complementary to the 3′ coding end of Vβ12, was elongated (<b>*</b>) only in the presence of the hexamer GTCGAG which is complementary to the 5′-end of the NDN sequence.</p> <p> <b>(F)</b> Detail of universal hexamer array after ligation of a Cy5-labeled oligonucleotide complementary to the 5′ coding end of Jβ1-2 in the presence of the antisense strand template of Jurkat CDR3β.</p> <p> <b>(G)</b> Signal intensities of all 4096 spots of the same array experiment.</p> <p>The arrow in (F) and (G) indicates the microarray spot with sequence GTTCGG.</p> <p> <b>(H)</b> List of 20 strongest spots with their hexamer sequence and Cy5-fluorescent signal.</p></div

Clonal expansion of T-cells from a CMV⁺ donor after antigen specific stimulation.

<div><p> <b>(panel A)</b> The fraction of antigen specific T-cell clones determined with NLVPMVATV-loaded tetramers.</p> <p> <b>(panel B)</b> Spectratyping of unsorted Vβ13⁺ and Vβ13⁺/Jβ1-2⁺ fraction.</p> <p> <b>(panel C)</b> CDR3 sequence of the clone identified compared to the Jβ1-2 germline sequence.</p> <p> <b>(panel D)</b> T-array of unsorted Vβ13⁺/Jβ1-2⁺ fraction.</p> <p>The annealer oligonucleotide used in this T-array experiment had the sequence ACTATGGCTACACCTTCGGTT, allowing detection of rearrangements with 3 or less nucleotides deleted from the Jβ1-2 germline.</p> <p>The arrow indicates sequence CCTTTT, the first nucleotides of the NDNβ region of the dominant T-cell clone that was identified in this screen.</p></div

Spectratyping and T-array for Jurkat T-cell clone mixed with peripheral blood CD4⁺ T-cells.

<div><p>Jurkat cells were added in different dilutions to a background of peripheral blood CD4⁺ T-cells.</p> <p> <b>(panel A)</b> CDR3 spectratyping with Vβ12-specific primer.</p> <p>The arrow indicates a length identical to 14 amino acids, which is the length of the Jurkat CDR3β.</p> <p> <b>(panel B)</b> A detail of the T-array scans.</p> <p>White arrows indicate hexamer sequence GTTCGG, which is complementary to the first six nucleotides Jurkat NDNβ region.</p> <p> <b>(panel C)</b> Signal intensities of all 4096 spots of the T-array.</p> <p>Black arrows indicate hexamer sequence GTTCGG.</p></div