Das SPlit ENds (SPEN) Gen – in vivo Analyse eines neuen Kandidatengens der dilatativen Kardiomyopathie im Modellorganismus Zebrafisch

Die dilatative Kardiomyopathie (DCM) stellt eine schwere kardiale Erkrankung dar und ist die häufigste Ursache einer Herztransplantation im Kindes- und Erwachsenenalter. Währenddessen multiple Faktoren zur Entstehung der DCM beitragen können spielt insbesondere die genetische Prädisposition eine entscheidende Rolle. Mittels Morpholino Oligomer-vermitteltem Gen-knockdown wurde die biologische Funktion des DCM-Kandidatengens spen im Modellorganismus Zebrafisch analysiert. Der Verlust der Funktion des transkriptionellen Regulators spen resultiert im Zebrafisch in der Entstehung eines schweren Herzinsuffizienz- und Arrhythmie-Phänotyps, welcher mit einer verminderten Expression von connexin 43 einhergeht. Interessanterweise phänokopiert der connexin 43-knockdown den spen-Kardiomyopathie Phänotyp. Zusammenfassend lässt sich hieraus die Hypothese ableiten, dass spen im Zebrafisch ein Regulator der Expression von connexin 43 im Herzen und hierdurch von essentieller Bedeutung für eine physiologische kardiale Funktion ist

Assessment of the expression of genes involved in Notch-signalin in Spen- and Connexin43-ablated zebrafish embryos

Our study on DCM-candidate gene spen in zebrafish suggests that loss-of Spen leads to development of heart failure and cardiac arrhythmia by downregulation of Connexin43 (Cx43). Since Spen is known to be a regulator of the Notch-signaling pathway via direct interaction with RBPJ, we assessed the regulation of Notch-pathway genes in spen- and cx43-morphants. Additionally, expressional levels of spen and cx43 were assessed in RBPJ-morphants. We found that there is no distinct and significant up- or down regulation of the analyzed Notch targets hey, her3.1, her6, her8.2, and myca in both, MO-spen and MO-cx43 injected embryos. The potential loss of Notch repression in spen morphants does not seem to be sufficient to decisively alter the expression of Notch target genes. Interestingly, the expression of notch1a, the membrane bound notch receptor, was significantly increased in both morphants. Intriguingly, in Notch signaling deficient embryos, which was achieved by rbpja/b-MO injection, we observed a downregulation of spen and cx43. Since RBPJ is the main switch of the Notch signaling pathway, one could assume that the Notch signal transduction cascade might somehow be involved in the regulation of cx43. Further deciphering of the molecular interplay of Cx43 and Spen is part of our future research. Methods: Morpholino and mRNA Injection Procedures: For all Morpholino-modified antisense oligonucleotide injection procedures, the TüAB wild-type strain was used. Morpholino-modified antisense oligonucleotides (MO; Gene Tools, LLC) were directed against the splice donor site of exon 1/intron 1 (5’ CTCAGCAAATCGTCACTTACCGTTT 3’) of zebrafish spen on chromosome 23 (MO-spensplice), the translational start site (5’ TCCCAACGCACTCCAGTCACCCATC 3’) of zebrafish connexin43 on chromosome 20 (MO-cx43ATG). For RBPJ knockdown a morpholine targeting the open reading frame was used (5' CAAACTTCCCTGTCACAACAGGCGC 3'). Reverse Transcriptase (RT)-PCR and quantitative real-time PCR: RNA isolation was performed by using Qiazol Lysis Reagent (Qiagen) according to the manufacturer’s instructions. cDNA was generated from RNA of 72 hpf MO-spensplice- and MO-Ctrl injected embryos using oligo(dT) primer and SuperScript III reverse transcriptase (Invitrogen). RT-PCR was performed according to standard protocols with cx43-, spen-, hey1-, her3.1-, her6-, her8.2- and myca- specific primers. Quantitative real-time PCR was carried out according to standard protocols with the SYBR-Green method (Bio- Rad) and an Eppendorf Realplex-2 cycler or a Roche LightCylcer480

Assessment of the expression of genes involved in Notch-signalin in Spen- and Connexin43-ablated zebrafish embryos

Our study on DCM-candidate gene spen in zebrafish suggests that loss-of Spen leads to development of heart failure and cardiac arrhythmia by downregulation of Connexin43 (Cx43). Since Spen is known to be a regulator of the Notch-signaling pathway via direct interaction with RBPJ, we assessed the regulation of Notch-pathway genes in spen- and cx43-morphants. Additionally, expressional levels of spen and cx43 were assessed in RBPJ-morphants. We found that there is no distinct and significant up- or down regulation of the analyzed Notch targets hey, her3.1, her6, her8.2, and myca in both, MO-spen and MO-cx43 injected embryos. The potential loss of Notch repression in spen morphants does not seem to be sufficient to decisively alter the expression of Notch target genes. Interestingly, the expression of notch1a, the membrane bound notch receptor, was significantly increased in both morphants. Intriguingly, in Notch signaling deficient embryos, which was achieved by rbpja/b-MO injection, we observed a downregulation of spen and cx43. Since RBPJ is the main switch of the Notch signaling pathway, one could assume that the Notch signal transduction cascade might somehow be involved in the regulation of cx43. Further deciphering of the molecular interplay of Cx43 and Spen is part of our future research. Methods: Morpholino and mRNA Injection Procedures: For all Morpholino-modified antisense oligonucleotide injection procedures, the TüAB wild-type strain was used. Morpholino-modified antisense oligonucleotides (MO; Gene Tools, LLC) were directed against the splice donor site of exon 1/intron 1 (5’ CTCAGCAAATCGTCACTTACCGTTT 3’) of zebrafish spen on chromosome 23 (MO-spensplice), the translational start site (5’ TCCCAACGCACTCCAGTCACCCATC 3’) of zebrafish connexin43 on chromosome 20 (MO-cx43ATG). For RBPJ knockdown a morpholine targeting the open reading frame was used (5' CAAACTTCCCTGTCACAACAGGCGC 3'). Reverse Transcriptase (RT)-PCR and quantitative real-time PCR: RNA isolation was performed by using Qiazol Lysis Reagent (Qiagen) according to the manufacturer’s instructions. cDNA was generated from RNA of 72 hpf MO-spensplice- and MO-Ctrl injected embryos using oligo(dT) primer and SuperScript III reverse transcriptase (Invitrogen). RT-PCR was performed according to standard protocols with cx43-, spen-, hey1-, her3.1-, her6-, her8.2- and myca- specific primers. Quantitative real-time PCR was carried out according to standard protocols with the SYBR-Green method (Bio- Rad) and an Eppendorf Realplex-2 cycler or a Roche LightCylcer480

Outcomes of patients with ST-segment myocardial infarction admitted during the COVID-19 pandemic – a prospective, observational cohort study from a tertiary care centre in Germany

Outcomes of Patients With ST-Segment Elevation Myocardial Infarction Admitted During COVID-19 Pandemic Lockdown in Germany – Results of a Single Center Prospective Cohort Study, Data supplementTHIS DATASET IS ARCHIVED AT DANS/EASY, BUT NOT ACCESSIBLE HERE. TO VIEW A LIST OF FILES AND ACCESS THE FILES IN THIS DATASET CLICK ON THE DOI-LINK ABOV

Supplementary Dataset to DOI: 10.3389/fcvm.2021.638954

Outcomes of Patients With ST-Segment Elevation Myocardial Infarction Admitted During COVID-19 Pandemic Lockdown in Germany – Results of a Single Center Prospective Cohort Study - raw dataset Supplement Frontiers in Cardiovascular MedicineTHIS DATASET IS ARCHIVED AT DANS/EASY, BUT NOT ACCESSIBLE HERE. TO VIEW A LIST OF FILES AND ACCESS THE FILES IN THIS DATASET CLICK ON THE DOI-LINK ABOV

Case report: takotsubo syndrome in infectious endocarditis

Background!#!Outcome of ischemic VT ablation may differ between patients with previous myocardial infarction (MI) in relation to infarct localization.!##!Methods!#!We analyzed procedural data, acute and long-term outcomes of 152 consecutive patients (139 men, mean age 67 ± 9 years) with previous anterior or inferior MI who underwent ischemic VT ablation at our institution between January 2010 and October 2015.!##!Results!#!More patients had a history of inferior MI (58%). Mean ejection fraction was significantly lower in anterior MI patients (28 ± 10% vs. 34 ± 10%, p < 0.001). NYHA class and presence of comorbidities were not different between the groups. Indication for the procedure was electrical storm in 43% of patients, and frequent implantable cardioverter defibrillator (ICD) therapies in 57%, and did not differ significantly between anterior and inferior MI patients. A mean of 3 ± 2 VT morphologies were inducible, with a trend towards more VT in the anterior MI group (3.1 ± 2.2 vs. 2.6 ± 1.9, p = 0.18). Procedural parameters and acute success did not differ between the groups. During a mean follow-up of 3 ± 2 years, more anterior MI patients had undergone a re-ablation (49% vs. 33%, p = 0.09, Chi-square test). There was a trend towards more ICD shocks in patients with previous anterior MI (46% vs. 34%). After adjusting for risk factors and ejection fraction, multivariable Cox regression analyses showed no significant difference in mortality (p = 0.78) and cardiovascular mortality between infarct localizations (p = 0.6).!##!Conclusion!#!Clinical characteristics of patients with anterior and inferior MI are similar except for ejection fraction. Patients with inferior MI appear to have better outcome regarding survival, ICD shocks and re-ablation, but this appears to be related to better ejection fraction when compared with anterior MI

Outcomes of patients with ST-segment myocardial infarction admitted during the COVID-19 pandemic

Background!#!Since the beginning of the SARS-CoV‑2 outbreak, healthcare professionals reported that patients admitted with ST-segment myocardial infarction (STEMI) were in worse condition compared to STEMI patients admitted before the outbreak. However, data on their outcomes are sparse.!##!Methods!#!We conducted a prospective, observational, cohort study of STEMI patients admitted during the COVID-19 pandemic from March 21, 2020 to July 31, 2020 (COVID-19 group). Clinical outcomes, 30-day mortality, and reasons potentially related to a delay in patient presentation were assessed and compared with STEMI patients admitted between November 1, 2019 and March 20, 2020 (pre-COVID-19 group).!##!Results!#!A total of 124 patients were enrolled, comprising 57 patients in the pre-COVID-19 group and 67 patients in the COVID-19 group. Significantly more patients in the COVID-19 group had a time to first medical contact of greater than 24 h. Additionally, those admitted during the pandemic had a significantly lower left ventricular ejection fraction (LVEF), worse thrombolysis in myocardial infarction (TIMI) flow, received circulatory support significantly more often, and had a significantly higher 30-day mortality. Furthermore, significantly more patients stated that 'information by the media' made them hesitate to contact the emergency medical services as soon as possible.!##!Conclusion!#!Here, we show that STEMI patients admitted during the COVID-19 pandemic had significantly prolonged times to first medical contact, were in worse condition at admission, and had an increased 30-day mortality. Additionally, we found that 'information by the media' made patients during COVID-19 hesitate to contact the emergency medical services. Consequently, public health strategies have to be developed to avoid potential excess mortality of STEMI patients during the pandemic

Impact of re-definition of paroxysmal and persistent atrial fibrillation in the 2012 and 2016 European Society of Cardiology atrial fibrillation guidelines on outcomes after pulmonary vein isolation

Purpose!#!In the 2016 European Society of Cardiology (ESC) guidelines for the management of atrial fibrillation (AF), the definition of AF type has been modified compared with the 2010 guidelines and its 2012 focused update. We compared the difference of single procedure outcomes using the definitions before and after 2016 on a cohort of patients with AF undergoing AF ablation.!##!Methods!#!Consecutive AF ablation patients with paroxysmal or persistent AF were retrospectively reclassified applying the 2010, 2012, and 2016 ESC definitions on AF type.!##!Results!#!We included a total of 628 patients. Applying the 2010 ESC AF guidelines definition, 68% of patients were paroxysmal while according to the 2016 ESC AF guidelines, the proportion increased to 87%. Applying the 2010 ESC guidelines definition, recurrence rates of paroxysmal and persistent AF patients differ significantly (log-rank p < 0.001). Applying the 2012 focused update and the 2016 ESC AF guidelines, recurrence rates do not differ significantly. In a cox regression model applying the 2010 guidelines, persistent AF is the only independent predictor of AF recurrence in our cohort. However, when applying the 2016 guidelines, persistent AF is no longer a predictor of AF recurrence.!##!Conclusions!#!The revised definition of AF types in the 2016 ESC AF guidelines leads to a marked shift from persistent to paroxysmal AF. It appears that the old definition provided a better separator to predict rhythm outcome after AF ablation

Impact of extent of coronary artery disease and percutaneous revascularization assessed by the SYNTAX score on outcomes following transcatheter aortic valve replacement

Objectives!#!The aim of the study was to analyze the impact of concomitant coronary artery disease (CAD) assessed by the SYNTAX score (SS) and periprocedural percutaneous coronary intervention (PCI) on outcomes after transcatheter aortic valve replacement (TAVR).!##!Background!#!Due to controversial data regarding the effect of CAD on outcomes after TAVR, proper revascularization strategies remain a matter of debate.!##!Methods!#!553 patients with severe aortic stenosis undergoing TAVR were included in this study. SS was calculated for each patient at baseline and after PCI. Primary outcome was one-year all-cause mortality.!##!Results!#!60.2% of patients (N = 333) exhibited CAD with a mean SS of 10.8 ± 8.8. Of those, 120 patients (36.0%) received periprocedural PCI. In the treatment group, mean SS was decreased from 14.9 ± 9.1 to 6.3 ± 6.7. Patients with concomitant CAD suffered more frequently from myocardial infarction (MI) post TAVR compared to those without CAD (2.1% vs. 0.0%; P < 0.01). In the CAD cohort, MI rates were comparable between patients with and without PCI (2.2% vs. 2.5%; P = 0.71). Regarding SS, patients with a residual SS < 8 showed significant lower rates of one-year mortality (9.0% vs. 18.2%; P = 0.016) and MACCE (16.5% vs. 32.2%; P = 0.001). Besides left bundle brunch, predictors for an increased one-year mortality were a residual SS ≥ 8 in the CAD group (OR = 3.17; P = 0.011) and a EuroSCORE ≥ 4% in the entire study population (OR = 2.18; P = 0.017).!##!Conclusion!#!Our results suggest that a residual SS-guided revascularization strategy may improve prognosis after TAVR in patients with concomitant CAD. PCI aiming for a residual SS < 8 was associated with improved one-year clinical outcomes

Predictors of worse outcome after postponing non-emergency cardiac interventions during the COVID-19 pandemic

Objective Deferral of non-emergency cardiac procedures is associated with increased early emergency cardiovascular hospitalisation. This study aimed to identify predictors of worse clinical outcome after deferral of non-emergency cardiovascular interventions.Methods This observational case-control study included consecutive patients whose non-emergency cardiac intervention has been postponed during COVID-19-related lockdown between 19 March and 30 April 2020 (n=193). Cox regression was performed to identify predictors of the combined 1-year end point emergency cardiovascular hospitalisation and death. All patients undergoing non-emergency interventions in the corresponding time period 2019 served as control group (n=216).Results The combined end point of death and emergency cardiovascular hospitalisation occurred in 70 (36.3%) of 193 patients with a postponed cardiovascular intervention. The planned intervention was deferred by a median of 23 (19–36) days. Arterial hypertension (HR 2.27; 95% CI 1.00 to 5.12; p=0.049), chronic kidney disease (HR 1.89; 95% CI 1.03 to 3.49; p=0.041) as well as severe valvular heart disease (HR 3.08; 95% CI 1.68 to 5.64; p<0.001) were independent predictors of death or emergency hospitalisation. Kaplan-Maier estimators of the combined end point were 31% in patients with arterial hypertension, 56% in patients with severe valvular heart disease and 77% with both risk factors (HR 12.4, 95% CI 3.8 to 40.7; p<0.001) and only 9% in patients without these risk factors (log rank p<0.001). N-terminal pro-B-type natriuretic peptide (NT-proBNP) cut-point of ≥1109 pg/mL best predicts the occurrence of primary end point event in deferred patients (area under the curve 0.71; p<0.001; sensitivity 63.8%, specificity 69.4%).Conclusion Our results suggest that patients with either arterial hypertension, chronic kidney or severe valvular heart disease are at very high risk for emergency hospitalisation and increased mortality in case of postponed cardiac interventions even in supposed stable clinical status. Risk seems to be even higher in patients suffering from a combination of these conditions. If the ongoing or future pandemics force hospitals again to postpone cardiac interventions, the biomarker NT-proBNP is an applicable parameter for outpatient monitoring to identify those at risk for adverse cardiovascular events