<i>brc-1(I23A)</i> and <i>brc-1(triA)</i> mutants show differential defects in promoting progeny viability and RAD-51 filament stabilization in the <i>zim-1</i> mutant.

(A) Embryonic lethality of brc-1 mutants in the zim-1 mutant background. Emb of brc-1(triA); zim-1 mutant (n = 14) is intermediate between brc-1(I23A); zim-1 (n = 12) and brc-1(null); zim-1 mutants (n = 15), zim-1 (n = 9). *** p brc-1(I23A); zim-1 mutant. (C) Cartoon of gonad indicating regions analyzed for RAD-51 foci pixel intensity. Graph shows average pixel intensity of RAD-51 foci from pre, in and post RAD-51 dark region in three germ lines of the indicated genotypes. brc-1(I23A); zim-1 contains nuclei with reduced RAD-51 foci intensity in the dark region but not to the extent of brc-1(triA); zim-1 and brc-1(null); zim-1 mutants. (D) Images showing part of the germ line from early/mid-pachytene (zone 2) to diplotene (zone 4) immunolabeled with RAD-51 antibody (yellow) and counterstained with DAPI (blue). Brackets indicate the presence and location of RAD-51 dark region in the mutant germ lines, which is not as pronounced in the brc-1(I23A); zim-1 mutant. Scale bar = 10μm (E) Scatter plot of number of RAD-51 foci per nucleus across the four zones. (F) Scatter plot of RAD-51 foci pixel intensity from pre, in and post RAD-51 dark regions in the germ lines. Mean and 95% CI are indicated for all data sets; statistical comparisons between genotypes are shown in S3 Table.</p

Analysis of <i>brd-1(null)</i>.

(A) BRD-1 exon structure and position of insertion of the stopin cassette. Primer pairs (P1-P3) used for RT-PCR of wild type and brd-1(null) cDNA are indicated. P1 Forward: cgccacatttcaacagaaacc, P1 Reverse: gcttctttgctgtagtcgtg; P2 Forward: cgcgtaattcgacaaaacgc, P2 Reverse: gcattaataactgcacccgc; P3 Forward: ggctcaacattagaaacaacgc, P3 Reverse: gatcaataatgcacgctctcag. ama-1 was used as control [95]. (B) Immunoblot of whole worm extracts of BRD-1::GFP::3xFLAG and BRD-1null::GFP::3xFLAG with indicated molecular weight markers. (C) No GFP fluorescence was observed in brd-1(null)::gfp worms. Scale bar = 10μm. (D) Male self-progeny (left Y axis; n = 12) and embryonic lethality (right Y axis; n = 18) of brc-1(null) and brd-1(null) worms. No statistical differences were observed by Mann-Whitney. (TIF)</p

BRC-1 nuclear accumulation and self-association are required to weakly bypass BRD-1 function.

(A) Embryonic lethality in the presence of 75Gys IR was examined in brd-1(null) (n = 21), gfp::brc-1 brd-1(null) (n = 27), gfp::brc-1(triA) brd-1(null) (n = 31), mScarlet::brc-1 brd-1(null) (n = 14), gfp(nd)::brc-1 brd-1(null) (n = 23). Mann-Whitney * p brd-1(null) germ cells in the absence (-IR) and presence of IR (+IR) expressing either GFP::BRC-1, mScarlet::BRC-1 or GFPnd::BRC-1. Scale bar = 10μm. (C) Coefficient of variation for GFP::BRC-1, mScarlet::BRC-1, and GFPnd::BRC-1 fluorescence in the absence of BRD-1 in the absence and presence of IR in mitotic and meiotic germ cell nuclei; a minimum of 4 germ lines were analyzed for each genotype. Statistical comparisons between—and + IR by Mann-Whitney * p triA chimera, and BRD-1-BRC-1triA chimera; boxed region shows presence of poly Ub-conjugates. (F) Quantification of polyubiquitylation signal between GFP::BRC-1 RING and GFP::BRC-1 RING in the presence of BRD-1-BRC-1triA chimera. p <0.01, Student T test.</p

Specificity of rescue of GFP::BRC-1 and GFP::BRC-1 RING purification.

(A) Embryonic lethality in the presence of 75Gys IR was examined in brd-1(null) (n = 21), brc-1(null) (n = 21), gfp::brd-1 (n = 12), brc-1(null) gfp::brd-1 (n = 10), brd-1::gfp (n = 11), brc-1(null) brd-1::gfp (n = 18), mScarlet::brc-1 (n = 14), gfp(nd)::brc-1 (n = 14). (B) Image of GFP::BRD-1 fluorescence in the brc-1(null) mutant. Scale bar = 5μm. (C) E. coli purified GFP::BRC-1 RING protein visualized on a stain-free gel with indicated molecular weight markers. (D) Immunoblot of GFP::BRC-1, mScarlet::BRC-1, and GFPnd::BRC-1 in the brd-1(null) mutant. (E) Quantification of relative steady state levels of GFP::BRC-1, mScarlet::BRC-1, and GFPnd::BRC-1 in the brd-1(null) mutant. (TIF)</p

BRC-1-BRD-1 E3 ligase activity is essential for recruitment of the complex to DSBs on meiotic chromosomes.

Images from live worms of meiotic (early-mid pachytene) germ cells expressing GFP::BRC-1 or GFP::BRC-1triA in syp-1 (A), him-3 (B), rec-8; coh-3 coh-4 (C) without IR, and (D) rec-8; coh-3 coh-4 mutants in the presence of 75Gys IR. Scale bar = 10μm. (E) Images of fixed mid-late pachytene nuclei labeled with anti-SYP-2 antibodies (red), BRC-1 (GFP fluorescence; green) and counterstained with DAPI (blue); scale bar = 10μm. (F) Number of GFP::BRC-1 or GFP::BRC-1triA foci observed in the different mutants; a minimum of 3 germ lines from half-projections were scored. Mann-Whitney *** pzim-1 (n = 10), gfp::brc-1; zim-1 (n = 12), brc-1(triA); zim-1 (n = 14), gfp::brc-1(triA); zim-1 (n = 11) animals. Mann-Whitney * p < 0.05.</p

BRD-1-BRC-1^I23A and BRD-1-BRC-1^triA chimeras are defective for E3 ubiquitin ligase activity <i>in vitro</i>.

(A) Construct and model based on AlphaFold of BRD-1-BRC-1 chimera: N-terminal BRD-1 RING domain (amino acids 1–107; blue), GGSGG linker (grey) and the BRC-1 RING domain (amino acids 2–106; purple) are connected to a superfold GFP (green) and strep II tag (orange) at the C terminus. Mutant chimera proteins contain either the single I23A or the I23A I59A R61A triple mutations (triA) in the BRC-1 RING, respectively. (B) Immunoblot showing auto-ubiquitylation (anti-HA-Ub, red) of BRD-1-BRC-1 chimera (anti-GFP, green) when incubated with E1, E2, HA-Ub and ATP for 60mins. *E1 incorporates HA-Ub (HA-Ub-E1) independently of E2 or E3s. Wild-type chimera promotes the formation of both auto-mono (mono HA-Ub) and polyubiquitylated (HA-Ubn) conjugates while only reduced levels of auto-monoubiquitin BRD-1-BRC-1 were present using mutant chimeras. (C) Quantification of total HA-Ub signal at the end of 60mins showed that I23A and triA chimeras produced an average of 14% and 12% of total ubiquitylation, respectively, as compared to the wild-type chimera (Student T test, *** pC. elegans ubiquitin incorporation into human histone H2A (anti-H2A) by WT and mutant chimeras; only WT was able to transfer ubiquitin to histone H2A protein to generate mono (Ub-H2A) and di-ubiquitin H2A (Ub)2-H2A, but no ubiquitin incorporation into H2A was observed with either the I23A or I23A, I59A, R61A mutant chimeras.</p

Nuclear accumulation of BRC-1 with impaired E3 ligase activity promotes viability in response to DNA damage.

(A) Embryonic lethality in the presence of 75Gys IR was examined in wild type (n = 33), gfp::brc-1 (n = 17), brc-1(I23A) (n = 19), gfp::brc-1(I23A) (n = 22), brc-1(triA) (n = 28), and gfp::brc-1(triA) (n = 32) animals. *** p triA in the absence (-IR) and presence (+IR) of 75Gys radiation. Scale bar = 10μm. (C) Graph shows nucleoplasmic to cytoplasmic ratio of GFP signal in gfp::brc-1 and gfp::brc-1(triA) strains. A minimum of 60 nuclei from 3 germ lines were analyzed. (D) Coefficient of variation (CV) for GFP::BRC-1triA fluorescence to reflect changes in localization (foci formation) in response to IR in mitotic and meiotic nuclei in the germ line; five germ lines were analyzed for each genotype. Statistical comparisons between—and + IR *** p < 0.001 Mann-Whitney.</p

RAD-51 statistical analyses.

(DOCX)</p

Mutation of three key amino acids in the BRC-1 RING domain leads to a more severe phenotype than the single I23A mutation.

(A) Sequence alignment of RING domains from human and C. elegans BRCA1 orthologs reveals that amino acids isoleucine 23, isoleucine 59 and arginine 61 in C. elegans BRC-1 correspond to isoleucine 26, leucine 63 and lysine 65 in human BRCA1 (highlighted in yellow). (B) Predicted structure of BRC-1 RING domain (green) determined by AlphaFold, superimposed onto the NMR structure of the human BRCA1 RING domain (purple) showing the three amino acids occupy the same physical position. (C) Male self-progeny, (D) embryonic lethality, and (E) embryonic lethality in the presence of 75Gys IR were examined in wild type, brc-1(I23A), brc-1(triA), and brc-1(null) animals. Number of animals examined in (C): n = 12 for all genotypes; (D): WT n = 26; brc-1(I23A) n = 12; brc-1(triA) n = 12; brc-1(null) n = 18; (E) WT n = 38; brc-1(I23A) n = 19; brc-1(triA) n = 39; brc-1(null) n = 21. *** p < 0.001; ** p < 0.01; * p < 0.05; ns = not significant by Mann-Whitney.</p

Nuclear accumulation and BRC-1-BRD-1 interaction are differentially affected by BRC-1^I23A and BRC-1^triA mutations.

(A) Images of germline nuclei showing BRD-1 immunolabeling (cyan) by anti-BRD-1 antibodies and corresponding DAPI. PZ = proliferative zone; TZ = transition zone; EP = early pachytene; MP = mid pachytene; LP = late pachytene; DP = diplotene stages in the germ line. Scale bar = 10μm. (B) Graph shows nucleoplasmic to cytoplasmic ratio of BRD-1 signal. 40 nuclei from proliferative zone to mid pachytene from 3 germ lines were analyzed. Mann Whitney *** pbrc-1 mutants normalized to wild type from 3 independent experiments. Student T test *** p<0.001. (E) Yeast 2-hybrid interaction between BRC-1 and BRD-1 as measured by growth on medium lacking histidine (-HIS) with +HIS as control. (F) Relative β-galactosidase activity assay showing reduced interaction between mutant BRC-1 (I23A and triA) and BRD-1 in corresponding yeast strains. Student T test *** p<0.001.</p