Genetic diversity of african and worldwide strains of Ralstonia solanacearum as determined by PCR-Restriction Fragment Length Polymorphism analysis of the hrp gene region

The genetic diversity among a worldwide collection of 120 strains of #Ralstonia solanacearum# was assessed by restriction fragment length polymorphism (RFLP) analysis of amplified fragments from the hrp gene region. Five amplified fragments appeared to be specific to #R. solanacearum#. Fifteen different profiles were identified among the 120 bacterial strains, and a hierarchical cluster analysis distributed them into eight clusters. Each cluster included strains belonging to a single biovar, except for strains of biovars 3 and 4, which could not be separated. However, the biovar 1 strains showed rather extensive diversity since they were distributed into five clusters whereas the biovar 2 and the biovar 3 and 4 strains were gathered into one and two clusters, respectively. PCR-RFLP analysis of the #hrp# gene region confirmed the results of previous studies which split the species into an "Americanum" division including biovar 1 and 2 strains and an "Asiaticum" division including biovar 3 and 4 strains. However, the present study showed that most of the biovar 1 strains, originating from African countries (Reunion Island, Madagascar, Zimbabwe, and Angola) and being included in a separate cluster, belong to the "Asiaticum" rather than to the "Americanum" division. These African strains could thus have evolved separately from other biovar 1 strains originating from the Americas. (Résumé d'auteur

Host plant-dependent phenotypic reversion of Ralstonia solanacearum from non-pathogenic to pathogenic forms via alterations in the phcA gene

Ralstonia solanacearum is a plant pathogenic bacterium that undergoes a spontaneous phenotypic conversion (PC) from a wild-type pathogenic to a non-pathogenic form. PC is often associated with mutations in phcA, which is a key virulence regulatory gene. Until now, reversion to the wild-type pathogenic form has not been observed for PC variants and the biological significance of PC has been questioned. In this study, we characterized various alterations in phcA (eight IS element insertions, three tandem duplications, seven deletions and a base substitution) in 19 PC mutants from the model strain GMI1000. In five of these variants, reversion to the pathogenic form was observed in planta, while no reversion was ever noticed in vitro whatever culture media used. However, reversion was observed for a 64 bp tandem duplication in vitro in the presence of tomato root exudate. This is the first report showing a complete cycle of phenotypic conversion/reversion in a plant pathogenic bacterium. (Résumé d'auteur

The Xanthomonas campestris type III effector xopAC triggers vascular immunity in Arabidopsis

Xanthomonas campestris pv. campestris (Xcc) is the causal agent of black rot on Brassicae and causes disease on crop plants such as cabbage or on the model plant Arabidopsis. The xopAC gene encodes a type III effector which is responsible for avirulence on Arabidopsis ecotype Col-0 exclusively when Xcc is inoculated in the leaf vasculature (1). PCRs and dot-blot hybridizations performed on a large collection of plant pathogenic bacteria revealed that avrAC is specific to Xc. The analysis of more than 50 Xcc strains reveals that avrAC displays a very low allelic diversity and belongs to the Xcc variable effectome. Moreover, the presence of avrAC is tightly correlated with an increase in Xcc aggressiveness on susceptible Arabidopsis. This correlation was experimentally confirmed by reverse genetic in several Xcc strains. In addition, xopAC is responsive for the appearance of necrotic lesions on nonhost pepper plants. We show that the "Leucine-Rich Repeat" (LRR) and "Filamentation induced by cAMP" (Fic) domains of XopAC are both required for avirulence on resistant Arabidopsis and necrosis on pepper. Interestingly, the Fic domains of the VopS and IbpA virulence factors from animal pathogens were recently shown to mediate protein adenylylation, a yet unknown protein posttranslational modification in plants (2,3). Strategies developed to dissect avrAC functions in planta and to study plant vascular immunity will be presented. (Résumé d'auteur

Recherche des cibles végétales de l'effecteur de type-III XOPAC de Xanthomonas Campestris pathovar Capestris (Xcc)

Xanthomonas campestris pv. campestris est une bactérie phytopathogène vasculaire responsable de la pourriture noire des Brassicacées comme le chou, plante d'intérêt économique, ou la plante modèle Arabidopsis thaliana. Xcc possède un système de sécrétion de type III lui permettant d'injecter des protéines de virulence (ou effecteurs) directement à l'intérieur de la cellule végétale. Le gène xopAC code un effecteur de type-III qui est spécifique des Xanthomonas campestris et qui est responsable de l'avirulence sur l'écotype Columbia-0 d'A. thaliana quand Xcc est inoculé directement dans la nervure centrale de la feuille (Xu et al., 2008). L'introduction de xopAC dans la bactérie Ralstonia solanacearum (pathogène vasculaire des solanacées) rend la bactérie avirulente sur Col-0. Ce résultat montre que XopAC est aussi capable d'induire une réponse immunitaire contre un autre pathogène vasculaire. La séquence protéique de XopAC possède un domaine LRR (Répétition Riche en Leucine) en N-terminal et un domaine Fic (Filamentation Induced by cAMP) en Cterminal. Le domaine LRR est un domaine d'interaction avec un ligand. Le domaine Fic issu de deux effecteurs de pathogène d'animaux entraîne la modification posttraductionnelle de thréonines ou tyrosines par adénylylation (rajout d'un groupement AMP; Worby et al., 2009; Yarbrough et al., 2009). Cette modification chez les plantes reste encore à déterminer. La présence des domaines Fic et LRR est essentielle pour la fonction d'avirulence de la protéine XopAC sur l'écotype résistant Col-0 d'A. thaliana, montrant ainsi l'importance biologique de ces deux domaines. En s'appuyant sur ces données récentes nous avons émis l'hypothèse que la protéine XopAC serait impliquée dans une interaction avec une cible végétale via son domaine LRR et dans sa modification posttraductionnelle (par adénylylation) via le domaine Fic. Nous vous présenterons Les expériences menées pour rechercher les cibles végétales de XopAC et étudier l'immunité vasculaire mise en place chez Arabidopsis contre Xcc et d'autres pathogènes vasculaires. (Texte intégral

Genome Sequences of the Race 1 and Race 4 Xanthomonas campestris pv. campestris Strains CFBP 1869 and CFBP 5817

Xanthomonas campestris pv. campestris is the causal agent of black rot on Brassicaceae. The draft genome sequences of strains CFBP 1869 and CFBP 5817 have been determined and are the first ones corresponding to race 1 and race 4 strains, which have a predominant agronomic and economic impact on cabbage cultures worldwide

Bacterial diseases of bananas and enset: Current state of knowledge and integrated approaches toward sustainable management

Bacterial diseases of bananas and enset have not received, until recently, an equal amount of attention compared to other major threats to banana production such as the fungal diseases black leaf streak (Mycosphaerella fijiensis) and Fusarium wilt (Fusarium oxysporum f. sp. cubense). However, bacteria cause significant impacts on bananas globally and management practices are not always well known or adopted by farmers. Bacterial diseases in bananas and enset can be divided into three groups: (1) Ralstonia-associated diseases (Moko/Bugtok disease caused by Ralstonia solanacearum and banana blood disease caused by R. syzygii subsp. celebesensis); (2) Xanthomonas wilt of banana and enset, caused by Xanthomonas campestris pv. musacearum and (3) Erwinia-associated diseases (bacterial head rot or tip-over disease Erwinia carotovora ssp. carotovora and E. chrysanthemi), bacterial rhizome and pseudostem wet rot (Dickeya paradisiaca formerly E. chrysanthemi pv. paradisiaca). Other bacterial diseases of less widespread importance include: bacterial wilt of abaca, Javanese vascular wilt and bacterial fingertip rot (probably caused by Ralstonia spp., unconfirmed). This review describes global distribution, symptoms, pathogenic diversity, epidemiology and the state of the art for sustainable disease management of the major bacterial wilts currently affecting banana and enset. (Résumé d'auteur

Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli

Screening Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprises detecting a combination (C1) of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB, where the result of the screening process is positive if the presence of two genes of the combination (C1) is detected in the biological sample. Independent claims are included for: (1) a nucleotide probe or primer used in a method of screening Xanthomonas axonopodis pathovar phaseoli, where the primer or the probe has a length of 12-30 nucleotides and comprising at least 12 consecutive nucleotides from a nucleic acid of the nucleic acid sequence of SEQ ID NOs: 5-12 (e.g. ccatgctgagcacggtcatt (SEQ ID NO: 5), cgccttccagttgctgacat (SEQ ID NO: 6), acgagcccttcccaaactagc (SEQ ID NO: 7), taccaacatcgtacgcttccc (SEQ ID NO: 8), cgtcagtgagtgctcggttg (SEQ ID NO: 9) and tcagagccctggaagcaaga (SEQ ID NO: 10)), and the nucleic acids of complementary sequence; and (2) a kit for detection of Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprising two pairs of primers for amplifying the combination of the two genes (C1) and the nucleotide probe or primer

Generation and analysis of a mouse intestinal metatranscriptome through Illumina based RNA-sequencing

With the advent of high through-put sequencing (HTS), the emerging science of metagenomics is transforming our understanding of the relationships of microbial communities with their environments. While metagenomics aims to catalogue the genes present in a sample through assessing which genes are actively expressed, metatranscriptomics can provide a mechanistic understanding of community inter-relationships. To achieve these goals, several challenges need to be addressed from sample preparation to sequence processing, statistical analysis and functional annotation. Here we use an inbred non-obese diabetic (NOD) mouse model in which germ-free animals were colonized with a defined mixture of eight commensal bacteria, to explore methods of RNA extraction and to develop a pipeline for the generation and analysis of metatranscriptomic data. Applying the Illumina HTS platform, we sequenced 12 NOD cecal samples prepared using multiple RNA-extraction protocols. The absence of a complete set of reference genomes necessitated a peptide-based search strategy. Up to 16% of sequence reads could be matched to a known bacterial gene. Phylogenetic analysis of the mapped ORFs revealed a distribution consistent with ribosomal RNA, the majority from Bacteroides or Clostridium species. To place these HTS data within a systems context, we mapped the relative abundance of corresponding Escherichia coli homologs onto metabolic and protein-protein interaction networks. These maps identified bacterial processes with components that were well-represented in the datasets. In summary this study highlights the potential of exploiting the economy of HTS platforms for metatranscriptomics

Exploration de la diversité génétique de Ralstonia solanacearum, agent du flétrissement bactérien. Détection et dynamique des populations dans les réservoirs d'inoculum

Le flétrissement bactérien, dont l'agent causal est R. solanacearum, est responsable de dégâts considérables sur un grand nombre de cultures, en particulier les Solanacées maraîchères et les bananiers, en zones tropicales et subtropicales. Seule une prophylaxie adaptée en complément de l'utilisation de variétés résistantes peut réduire l'incidence de la maladie. L'optimisation de la lutte implique une meilleure connaissance de la diversité génétique de l'agent pathogène mais aussi des réservoirs d'inoculurn. La diversité génétique de l'espèce R. solanacearum a été évaluée à l'aide de divers outils moléculaires et l'exploration de plusieurs régions du génome. Ces études ont permis de confirmer les divisions 1 ("Asiaticum") et 2 ("Americanum") au sein de l'espèce mais surtout d'identifier une nouvelle subdivision constituée uniquement de souches africaines. Par ailleurs, l'AFLP (Amplified Fragment Length Polymorphism) s'est révélée une technique de choix pour l'étude de la structure d'une population naturelle de R. solanacearum. L'exploration des gènes hrp a été un choix pertinent pour l'obtention d'un outil moléculaire, N-PCR-RFLP (Nested-Polyrnerase Chain Reaction - Restriction Fragment Length Polymorphism), capable de discriminer les biovars ou des groupes de biovars de R. solanacearum mais aussi d'assurer la détection efficace de la bactérie dans ses différents réservoirs. La maîtrise d'un tel outil pour la détection dans le sol constitue un résultat majeur de ce travail. Nous avons clarifié et approfondi certains aspects de la biologie et de l'épidémiologie de la bactérie. Nous avons confirmé que l'eau est un milieu dans lequel la bactérie peut se conserver et qui est susceptible d'assurer efficacement sa dissémination. De même, la semence peut être désormais considérée comme une voie potentielle de transmission de la maladie. Enfin, il apparaît que la durée de survie de R. solanacearum est limitée dans un sol nu et que le type de sol est un facteur influencant la conservation de la bactérie mais aussi l'expression de la maladie. (Résumé d'auteur