A Unique Subset of Self-specific Intraintestinal T Cells Maintains Gut Integrity

Lymphocytes residing in the intestinal epithelium are exclusively T cells and account for one of the largest collection of T cells in the organism. However, their function remains obscure. We and others have shown that the development of intestinal intraepithelial T cells is compromised in mutant mice prone to chronic intestinal inflammation. These results led us to directly assess their role in regulating the development of colitis secondary to transfer of primary splenic TCRαβ+CD4+CD45RBhi T cells into severe combined immunodeficiency (SCID) mice. Here we demonstrate that prior reconstitution of SCID recipients with intraintestinal TCRαβ+CD4−CD8α+β− T cells prevents disease, and does so in an interleukin (IL)-10–dependent fashion. In contrast, reconstitution with either TCRγδ+ or TCRαβ+CD4− CD8α+β+ intestinal T cells did not prevent colitis. TCRαβ+CD4−8α+β− T cells are unique to the intestinal epithelium of both rodents and humans. Previous repertoire analyses of TCRαβ+CD4−CD8α+β− T cells revealed a high proportion of cells expressing high affinity, self-specific TCR within this subset. We demonstrate that monoclonal, self specific TCRαβ+CD4−CD8α+β− cells derived from TCR transgenic mice also prevent the onset of colitis. Thus, intestinal TCRαβ+CD4−CD8α+β− T cells, selected based on their self-reactivity, maintain gut integrity in a IL-10–dependent fashion

Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli

Screening Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprises detecting a combination (C1) of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB, where the result of the screening process is positive if the presence of two genes of the combination (C1) is detected in the biological sample. Independent claims are included for: (1) a nucleotide probe or primer used in a method of screening Xanthomonas axonopodis pathovar phaseoli, where the primer or the probe has a length of 12-30 nucleotides and comprising at least 12 consecutive nucleotides from a nucleic acid of the nucleic acid sequence of SEQ ID NOs: 5-12 (e.g. ccatgctgagcacggtcatt (SEQ ID NO: 5), cgccttccagttgctgacat (SEQ ID NO: 6), acgagcccttcccaaactagc (SEQ ID NO: 7), taccaacatcgtacgcttccc (SEQ ID NO: 8), cgtcagtgagtgctcggttg (SEQ ID NO: 9) and tcagagccctggaagcaaga (SEQ ID NO: 10)), and the nucleic acids of complementary sequence; and (2) a kit for detection of Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprising two pairs of primers for amplifying the combination of the two genes (C1) and the nucleotide probe or primer

Fast Side-Channel Security Evaluation of ECC Implementations: Shortcut Formulas for Horizontal Side-channel Attacks against ECSM with the Montgomery ladder

Horizontal attacks are a suitable tool to evaluate the (nearly) worst-case side-channel security level of ECC implementations, due to the fact that they allow extracting a large amount of information from physical observations. Motivated by the difficulty of mounting such attacks and inspired by evaluation strategies for the security of symmetric cryptography implementations, we derive shortcut formulas to estimate the success rate of horizontal differential power analysis attacks against ECSM implementations, for efficient side-channel security evaluations. We then discuss the additional leakage assumptions that we exploit for this purpose, and provide experimental confirmation that the proposed tools lead to good predictions of the attacks\u27 success

Simple Key Enumeration (and Rank Estimation) using Histograms: an Integrated Approach

The main contribution of this paper, is a new key enumeration algorithm that combines the conceptual simplicity of the rank estimation algorithm of Glowacz et al. (from FSE 2015) and the parallelizability of the enumeration algorithm of Bogdanov et al. (SAC 2015) and Martin et al. (from ASIACRYPT 2015). Our new algorithm is based on histograms. It allows obtaining simple bounds on the (small) rounding errors that it introduces and leads to straightforward parallelization. We further show that it can minimize the bandwidth of distributed key testing by selecting parameters that maximize the factorization of the lists of key candidates produced by the enumeration, which can be highly beneficial, e.g. if these tests are performed by a hardware coprocessor. We also put forward that the conceptual simplicity of our algorithm translates into efficient implementations (that slightly improve the state-of-the-art). As an additional consolidating effort, we finally describe an open source implementation of this new enumeration algorithm, combined with the FSE 2015 rank estimation one, that we make available with the paper